Transcript

tmem242-201

ID
ZDB-TSCRIPT-090929-267
Name
tmem242-201
Previous Names
  • tmem242-001
  • si:dkey-60a16.5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000004459 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000004459|OTTDARG00000004244|ZDB-GENE-040724-146 tmem242|OTTDARP00000004052 tmem242-001 LG_none AL953887.10,BX649499.11 Danio rerio protein_coding KNOWN, 921 bp
GGACTCGTCTGTAGGTCGGACCTATTCAAGATGTCAGTAG
AGCAGGCGAGCGCGAGCGGAGCAGTCAGTGACATTGTAGA
AGATGACAAATCACATCTGATTAAAGGCGGTGCTTTTCTC
GCTACCGTGGCCACTGCAGGCATGATTGCAGGCTTTGGTG
CAACCCTAGCTGTGGCTAAGAAGAAGAGTCCGGACTGGTT
TAATAAGGGTATAATAGGAAGTGCTGCGGTGCCAGAAAGC
GGCGCGTCTTTAGCATTGCGGGCGTTGGGATGGGGTTCAC
TTTACGCCTGGTGTGGAGTCGGCCTTCTCAGCCTCACCAT
TTGGAAGGCTATGGGGGTCCACAGTCTACAAGAATTTCGT
CAAAAAATGCAATCCATTTTCCCTGCCATCCCTAAAAATG
AAGACGCTCAAGCCAATTCTGTTCCTTTTGACTGGAATTC
CATCTTCAAGTCAAAATGAGCTGAAATGTCGATTAGCAAG
AACACGCAGACTTAACGGACTGTGGAAATGTATCGTATGG
CCGCTTTTAATCAAGTGTGAGGCAACAGGACAGCCATATT
TGGCCCAGTTACCGGATTAAACATCAAGCATGAGGTCAAA
GCACTGGAGAACGGCTGTCTAGAGGCCTGAAAGACTCCAC
ACTTGATTATGTTTGCTGGATTCCACAAGAAGAGACTCTA
TGTTTGTACATACTGTAATATCTGAGACCTTATTTAATTC
ACAGCTTTGCAATCTTGCTAAAACAGTGGCCTTGTGTTGT
TGTTTTGGTAAACATGCTGTTGGAACATTAGTTGTCCTTA
AAATGAGAATAATTTACCCTTCGGCTGGTGTTTTTTTACG
GTAAATGTATCAAACTAAAGCATCTTTTGTTTGAAATATG
GTGTCGTGGTTACAAGGTCTAATAAAAGCATCTCACAATA
A

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations