Transcript

zgc:113232-202

ID
ZDB-TSCRIPT-090929-2568
Name
zgc:113232-202
Previous Names
  • zgc:113232-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000013564 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000013564|OTTDARG00000011628|ZDB-GENE-050327-86 zgc:113232|OTTDARP00000011580 CH211-149P10.3-001 LG_ AL929190.3 Danio rerio protein_coding KNOWN, 2409 bp
AGGGGGACCAGCATCACACACAGGGCAGAAGAATGTTTTG
ACCACAGAAGCCCCTCATTGAAACGGTGCTGGCTGCATTC
TCTGAAACCCCTAGACTGCACTTACCCAAGGAATCAGAGC
TCTGTCCGGAAAGCAACCGTCTGGCAACCTGAGCAGGAGG
CTGCTGGCCATGGGAGCCTCCAGGGTGAAGGTATGGACCG
TGTCGCTCAGCTCTGTGTTCCTGCTGTGTGTTCTGCAATC
TCACGCCCAGCAGGATTATTCAGGGTTACTTTCAGGAGAG
CGCATGTATGAAGGCTCCATAGCTGAACGATATGATGAAC
ATTCTGGATACAAATACAGAGTTGATTATCCTGCAGAGTC
CAAACGCGGCAGTGAAGACGAGCTCTCAGCATCTGGATTT
GACCCATACGCCCCTGCAGGCACCATGGTCACCATGATCA
CTGAAGAAACCTACCCATACTCCACAGGAGAGGAGTCTTT
TGATTACGCCAAAGAGGACAAAACCTTGATGACACAGGTC
CCATATGGAGGAGATGCTGAGTTGGGACAGGAGGGACCTA
CAGAATGTGACTGTGAACCAGGAGAGCCTGGATTTGGAGG
CTTTGCGGGACCTAAGGGTTCAAGGGGTCTACAAGGGAAA
CAGGGCTTCCCTGGAGTTCAAGGAAGGGAGGGTTACAAAG
GGACAAAAGGAGTGCGAGGAAGAGGCGGAGACACTGGTCC
TGAGGGCGACTCTGGGCTTGATGGAGAGGATGGTGCATCT
GGCTTCTTTGGTGCAATTGGCCTTCCCGGTTTGCCAGGTG
ACCCAGGTGAAACTGGACAACTTGGAGTGAAGGGTGATAT
CGGAATAGAAGGTCCTCGTGGAGGAGTCGGTCTCCATGGA
AAGACTGGACCTGTTGGGCCAAAGGGTAAATCTGGAAAAC
TAGGAGGGAAAGGTGTTAAGGGACAGACAGGAGCACCTGG
ATTCTCAGGAGACCGTGGAGAGCAGGGTTACTTGGGTTAT
ACGGGAGTTCCAGGAGACCGGGGGCGGACAGGACCAAAGG
GAAGTAAAGGTACTGGTGGCTTACCAGGAAGTGACGGAGA
GCCAGGAGAGGATGGCACTGTGGGTGTTCCAGGAGTTGTT
GGGGTTCCAGGGGCTTTTGGACCTAAGGGTATGAAAGGGG
ATCGTGGTCTGAGGGGGCGAACTGGACGAGTAGGATCTGT
GGGTCCACAAGGAGACAGTGGAGATGCAGGGATTTCAGGG
AAACCCGGGCCAAAAGGCTTGCCTGGACCAACAGGTGCCA
AAGGGGAAACAGGACCAGATGGTGAAAAGGGGTCACTGGG
ACGAAAAGGAGGAAAGGGTGCTAAAGGAGATAAGGGAGAC
GCTGGATCTCGTGGTGACAAAGGGCAGCATGGAGTGAAGG
GCCGACTGGGCCGTGATGGACTTGCTGGTCCTATTGGACC
TCCTGGTCTGCCTGGTCCCAGAGGAGATGAAGGCCCTCGA
GGAGACCTGGGAGACAAAGGACAGAGCGGCCCAAAAGGAG
AGCCAGGTGAAATTGGTCCGGGACTGACGGATGAGCAGAT
CCTGCAGCTTTGTCAAGGTGTGGTCATGGCTCAGATCTCC
CAGTATGCTTCATCCATACGTGCCAAATGCGTTCAGGGCT
GTCCCGTCAACAACCGTACCCTCATCGGACCCCCAGGAGG
CACGGGGCCACGTGGAAGTCCAGGCAAAGCTGGTAAAGCA
GGAAAGACGGGTGCTAAAGGTGAAAGAGGCCCTCAAGGCA
TCAAAGGAGTCGAGGGCCAAAAAGGAGCTCCAGGAGAAGC
TGGTGCTAAAGGTCAGAAAGGACAGAGAGGTGATGCTGGC
AAAGGTCTACCAGGACATGATGGTCACCAAGGCCTCAGAG
GACTACCAGGCCATCCAGCAGAGCCTAAAGCTGGAATTGA
GGGCCCACGTGGACCCCGAGGGTTTCCAGGACCTGTGGGT
CAGACTGGAATGGCCGGCAGTGCAGGAATACCAGGAGTGT
GTGAGGCACGTGACTGCAGCATTCATGCACCTGTAGTGCG
CAAGGAGATGGGACTGGTCAAAGGCCCCGGCAGCCAGGCC
TAACAAACACTAACCCGGGATAAGAAAATTGCGCTGTCGA
TGAAAGATGTCAGAGAACGACAGACTGGAGATCAAAGATA
CAGAAATTACCAGCACTTTCATCGCTTTTCACAATGTTTT
GGTTTCACTACGAATACAGTACAGACATGTAAATAATTTT
GTAAAGCATCCTAAATCCACATCTGCTGTGTCCTGAAATA
GCCTTTGTTTTGTTTTTCTTCACTGAAAATGAACTAAATT
ATTTAGACAAAGCAGTTTTGTTCAGTAGCTTCAACATATT
TCTTTTCATTTTATCCATCAAGAGTAAATAAAGAGATGTT
TTTTGTAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations