Transcript

zbed4-202

ID
ZDB-TSCRIPT-090929-2363
Name
zbed4-202
Previous Names
  • zbed4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000012923 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000012923|OTTDARG00000011127|ZDB-GENE-041210-305 zbed4|OTTDARP00000011093 DKEY-164M14.5-001 LG_ CR751234.13 Danio rerio protein_coding KNOWN, 4961 bp
CGCTACTACAGCGCACTGTTTACGGCACAGAAGACAAAGC
AACCAACTCAATTACAACACTGGATCAACCATACGCTTTA
TTTAACCATTTCACAACCGAAAGTCGCATAAGTAAACCTC
AGGATATAAAGATTCTACAAATGAATACAAGTGATTTATG
CTGTCTTAAGTGGAGCTCCTTCTATCTGTGGCATCAGTTC
TCCAATATAACATGTCTAACATGTAAGTAAACACTTGGAT
GGAGAAAGCCACACTCATGACACTTGGAGACTTAAAAAAG
CTGCTTTGAATAGAGGACATTTTCTTTCCCTGCAGAATTT
TTTTCTGCAATAATGGACAGTGAAGACAGCCTCTCACAAA
AGACTGAGGTTGCAAGCCATAGGCATAATGGCTCCAAAGA
TAACAAAAGAATTGAGGCCAAAGGAACCTGTTTAAAAATC
GAAGGGAAAGATGGGTATGTGTTCAAATCATACAGAATTA
CTCCTCAAGAGATACTGGAATCAGAGTTTCATACCTGTCC
CTCTGAGACACTGGCAAAAGACTCTTCTTTGGTGTCTTTA
TCATTTGAGTCCACAGAGGAAGATGGATCTTCTGAGGTTG
AAAGGCTTTCAACTGAGGATTCGACAGCAGAATCTTGTGA
AAAGCATGATTCTCAAACATCTCCAAATATTTCAAATAAG
AGCCAGAACACTGAAATAAATAACTCAGAAACTGAAACAA
GTGTATGCATCAAAGCAGAACCAAAAGTAACAGGTGAAAA
TGCTCAGGATGATGAAAAGCTAGCATTTGATGGAACATTT
GGGCCCTTTGCCACCAGGGGTTATGATGATGATTATGGTA
GCTTGTTCAGTGGCTATTCAAGTACTCTTTATGATGTTGC
AATGGATGCTGTGACACAAAGCCTTCTGTCATCCATAAGA
AGTCCCCTTAACCCTAGAAAAAAATCTCCTGCTTGGAACC
ATTTTTTCATATCACCACGTGATAGTACCAAAGCAATCTG
TATGTACTGTATGAAAGAGTTCAGTCGGGGTAAAAATGAG
AAAGACCTCAGTACTAGCTGTTTAATGAGGCATGTGCGAA
GAGCTCACCCCAGTGTTCTTCTGCCAGACAGTGACTCATT
AAATAATTTGTCCAATAATTCATCTTTAATACCTCCCAAC
ATATCACCAAACAATGGAGATTTGCCTGCAAGCATGAAGT
CCTCAACAGAAAACCATACTCAACTGTCCTCCTTTCTAGT
TGAGGCCACAGACATGGTGCCCAAAGAGTCTTTACAAAAA
GTAAAACCAAAAGGAGAAAAGAGTGTCAAGGGTGACTCTA
TTGCTGTTCAGTCCCCACATTCCTTTAACAACCATAATGA
GGATGCTACAGACTTTGGGACTGAATGCCCTGGATCAGCC
CCTAAGAGCTCAAGTTCTCGGCGGCGTTCAGCAGTGTGGA
AACACTTTTATTTATCCCCTGCTGACAGCTCAAAAGCAGT
GTGTATTCACTGTATGAATGAGTTCAGTCGTGGAAAAAAC
GGGAAAGACCTGGGGACGAGTTGCCTTATTCGCCACATGT
GGCGAGCCCATAGAGACATAGTCATTGATGAAAATGGGCA
GGGCTCAAGCATTCCTCCGCCTTACACGACTCCACCAACA
CTGCTTTCACGCACACAGGATTCCACAGATGTCAAAAAGG
AATCCCTCTGTACCTCACACAACCCAGATACCATATCAGA
CAAAATGCCCAATGATGACAGTGAGAACATGACTCTTGAA
GATGAGAATGATGCCACATATCAGTCCAGAGAAGAGTCCT
CAATTGATCAATGTTTACTGAAAGGGGAAAGCATACCACT
GTCGTCCTCTCCAGAGGAACACACTGATGGGCACAGCATA
ATATCTGAAGATCAAAGCTCAGTTTTTCAACAAAATAAGA
AAATTATGAAACGGGTGAAATCAGAAGTATGGCATCATTT
CATTGTCTCCCCCGTTGACCAACTCAAAGCTTTGTGTCGG
TATTGTCCCTGTGTCATAAGTCGTGGTAAAAGAGGAGACT
TTGGCACAAGCTGTTTAATGCGACATTTAATGCGGCGACA
TCCTGATGTTTTAAAAACCCCAAAAAGCACAAGTGATAAA
GTTTCCTCACCCCAATCACCCCACTCCAATCATGCAGCCG
AGGACTTGGCAACAGATACCCTTGCTGCTGAGAACAAACC
CCACACCTTGCCCATTTTCAGCAAAAAGACTTCAAAACTA
TGGAATCACTTTTCTATTTCATCTGCAGACCCAACAAAGG
TAGTCTGTTTGCACTGTAGCCGCACAATTAGCAGGGGAAA
AAAGACAACAAATTTAGGCACTAGCTGCTTATTTAGGCAC
ATGCAGAGATTTCATGGCCATGTGCTTGAAAATAATAGCA
ATATCTCAGGTGATGGGCCATCTGCTGAAACTCAAGTTAA
GCAGGAGCTCATGGACATTTCTACTTATCAGGAAAACGCA
GAAAAGTTCAGTGAATGCCACCCAGCTGCCAAAAAAATCA
CCAAACTCATTGCAGAAATGCTTGCACTGGATCTTCAGCC
ATCAACTGTAGTGGAAAATGTTGGCCTGAATCGCTTACTG
GAATACCTCCAGCCACAGTATTCTTTACCTCCCTCATCCT
ATTTTACCAGCACAGCAATCCCAGAAATGTATGAAAGTGT
TAAAGAAGTAGTTCTTACCCACCTCAAGGAAGCTGAAGGT
GGAATCATTCATTTCACAACAAGTGTTTGGATAGGCAGCC
AAACTCAAGAGTACTTGATTCTTACAGCCCACTGGGTGTC
ATTTGAGTCTCAAGTTCTGCCTCAGGGGCAAGATTTCCAC
TGCTCGGCCCTCCTTGGTGTTGCCTCAATTGACTGTGACT
ACAATATGCTGAACATACAGAAGCAGCTTGAATATCTTTG
GGACACTTGGATGGGTTCCTCAGGCCTTAAAATTGGATTT
ACTGTAACAGATAATCAAACAATTAGAAATGTTCTGGAGA
GCTGTGACCACACCACCATGCAGTGTTTTGTCCATAACAT
AGATCTGATTGTTAATGAAGCCATAAAAAGCCAGAGGATG
GTTCAGAACTTGCTTAGTATTGCTCGAAAAATCTGTGAAA
GAGTGCATCGTTCTGCTAAAGCAAAAGAGAAGTTGGCGGA
GCTACAAAAAGTATATCAGTTACCTGAAAACCAACTGGTT
CAAGATGTTCCATCGAAGTGGAAAACATCCTACTTTATGC
TTGAGCGATTAGTAGAGCAAAAGAAAGCAATTGATGAGAT
GTCAATCGAGTGCAATTTCAGGGAACTGATAAGTTGTGAC
CAGTGGGAAGTGATGGGGTCAGTCTGCAACGCTCTTAAGC
CTTTTGTGGTAGCCTGCAGGGAGATGAGCAATCGCACTGC
AACACTAGGTCAGGTCATTCCACTCATTCACATACTCAAC
CGAAAGATAGACATGCTTTTTGATGAGACCATGGGTATTG
ACAATATGCTCAAGTCTTTAAAAGAGGCATTGGTGACAAG
AATGTCCCCTACACTTCATGATCCCAGGTACATATGGGCA
ACCATGTTGGACCCGAGGTACAAGACCTCCCTCTTTACTG
AGGAAGAAGCGGAGCAGTGTAAGCATGACCTCATACAAGA
GCTTGAGGTGTCTACATCTAATTCTGCAGAGACGAAGACA
CCTTTGTCAAATGGATGCAGTGAAATACCTGCTTCATCAA
ACAGCTTGGCCTCAAACAAAGAGAACCTCTGGTCTCTTAT
GGATGACATTAGACAGAAAATCAAGCAAGAGGAGAAACCA
AAATCACTGGAGCTTGCTGTTCTTGAGTATTTGGAGGAGG
ACATTCTTGACCAGAGTTGTGATCCTTTAGATTATTGGAA
CCTAAAGAAGTTACTGTGGCCAGATCTTGCCAAAGTAGCT
GTACGCTATGTGGGTTGTCCACCCAGCATTGTACCAGCAG
ATACACTTTTTAGCACATCAACTGTCAACTGTGCCCTGAA
TCAGTCCCGACCATTGCTAGAAAATTTCGAAGGACTTCTA
TTTTTAAAAGTCAACCTTCCTTTGATATATTTTCAGTACT
GAATATTGTGTTTTAATATTTTCAAGTCTGTTTTATGCTC
TGAACCTCAGCCTTGGACCACTCAAGTTACTTTTTTGAGA
AGGCCTAATTACTTACAAATCTTTTTTTTTTTCTCTCTCT
CTCTCTCTCACTATTTGTCTCTGAGGTTCATATTCAAAAT
ATCATTTGGATGCTATTTAACTTGAATATTTTTTTTTAGC
TGGTTTGAATAAGATTGTAATGAGTACTACTGTTGAGTAC
ACTTGATAACTGGAGTCTTATTCCTGGTGAAGTGTTTTCA
GGGAGGGAGGGTTATCTAGCTGTATGGTTAGTTACTGTTT
GTTGCTGTATTTAGATTTTATTTTATAAATATATTTTGTC
TTCTCTCTCCTTGTGCCTTATACAAACTACTTCAGGTCAA
CATGCTGTAAATATAAACTGATGTGCAAAGCAAGTCATAG
TCTTCTGATTTAAATGATTTTATAAAATGAAACGTACATG
ATGAATACTGTTTTATATATATATGATTATATACATGGCC
CAAAATAAATGCTGTGACAGATGTTTTAAATGTATTTTAT
TTAATTATTTTGTGATTTTTGTGGCTTATGGTACTGTTAG
AATTATGGTTATTTTTATTTTTGTATTATTATTTTATAAT
TTTTTTTGGCAAATGATTTTGTATGTTAATGTACATAATG
CTGTACTTTTCAGGTTCAAATGTTTTGAAAAATTGTCTTA
AGCACAAATCAGTTTTTATATAAAGGGTTAAATTATGGGA
CATCAAGGAAATGTACTGTACAATTTATAAATGGTTTCTA
AAATATAATTTGATAGGAAGAATTCAGACTGGAACAATTA
GTTGTTTTGTGTTCATTTGTAAATAAAATATTACACTTTG
A

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations