Transcript

mir430g-001

ID
ZDB-TSCRIPT-090929-23582
Name
mir430g-001 Nomenclature History
Previous Names
None
Transcript Type
miRNA
Annotation Status
Annotation Method
Associated With Genes
Strain
Non Reference Strain
Genome Resources
None
RNA Central
None
Note
None
Sequence
ZFINNUCL0000000016 [ Show ] (double-click sequence to select) [Download]
>lcl|ZFINNUCL0000000016|ZDB-GENE-050609-32 CuratedMicroRNAMature mir430g GENE 22bp
TAAGTGCTATCTGTTGGGGTAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations