Transcript
mir430e-001
- ID
- ZDB-TSCRIPT-090929-23580
- Name
- mir430e-001 Nomenclature History
- Previous Names
- None
- Transcript Type
- miRNA
- Annotation Status
- Annotation Method
- Associated With Genes
- Strain
- Non Reference Strain
- Genome Resources
- None
- RNA Central
- None
- Note
- None
Sequence
| ZFINNUCL0000000014 [ ] (double-click sequence to select) | [Download] |
>lcl|ZFINNUCL0000000014|ZDB-GENE-050609-30 CuratedMicroRNAMature mir430e GENE 23bp AAAGTGCTAACAAGTTGGGGTAG
Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations