Transcript

mir737-001

ID
ZDB-TSCRIPT-090929-23527
Name
mir737-001
Previous Names
None
Transcript Type
miRNA
Annotation Status
miRBASE
Associated With Genes
Strain
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Target Genes
Sequence
MIMAT0003768 (1) [ Show ] (double-click sequence to select) [Download]
>lcl|MIMAT0003768|ZDB-TSCRIPT-090929-23527 LoadedMicroRNAMature mir737-001 miRNA 21bp
AATCAAAACCTAAAGAAAATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations