Transcript
mir732-001
- ID
- ZDB-TSCRIPT-090929-23521
- Name
- mir732-001 Nomenclature History
- Previous Names
- None
- Transcript Type
- miRNA
- Annotation Status
- miRBASE
- Annotation Method
- Associated With Genes
- Strain
- Non Reference Strain
- Genome Resources
- RNA Central
- None
- Note
- None
Sequence
| MIMAT0003762 (1) [ ] (double-click sequence to select) | [Download] |
>lcl|MIMAT0003762|ZDB-TSCRIPT-090929-23521 LoadedMicroRNAMature mir732-001 miRNA 22bp CTCAAAGCAGAGAACTCTCGGT
Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations