Transcript

mir460-3p-001

ID
ZDB-TSCRIPT-090929-23499
Name
mir460-3p-001
Previous Names
None
Transcript Type
miRNA
Annotation Status
miRBASE
Associated With Genes
Strain
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Target Genes
Sequence
MIMAT0001888 (1) [ Show ] (double-click sequence to select) [Download]
>lcl|MIMAT0001888|ZDB-TSCRIPT-090929-23499 LoadedMicroRNAMature mir460-3p-001 miRNA 22bp
CACAGCGCATACAATGTGGATG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations