Transcript
mir365-001
- ID
- ZDB-TSCRIPT-090929-23486
- Name
- mir365-001 Nomenclature History
- Previous Names
- None
- Transcript Type
- miRNA
- Annotation Status
- miRBASE
- Annotation Method
- Associated With Genes
-
- dre-mir-365-2 (1)
- dre-mir-365-3 (1)
- mir365-1 (1)
- Strain
- Non Reference Strain
- Genome Resources
- RNA Central
- None
- Note
- None
Sequence
| MIMAT0001875 (1) [ ] (double-click sequence to select) | [Download] |
>lcl|MIMAT0001875|ZDB-TSCRIPT-090929-23486 LoadedMicroRNAMature mir365-001 miRNA 22bp TAATGCCCCTAAAAATCCTTAT
Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations