Transcript

mir301b-001

ID
ZDB-TSCRIPT-090929-23482
Name
mir301b-001
Previous Names
None
Transcript Type
miRNA
Annotation Status
miRBASE
Associated With Genes
Strain
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Target Genes
Sequence
MIMAT0001871 (1) [ Show ] (double-click sequence to select) [Download]
>lcl|MIMAT0001871|ZDB-TSCRIPT-090929-23482 LoadedMicroRNAMature mir301b-001 miRNA 22bp
CAGTGCAATAGTATTGTCATTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations