Transcript

mir451a-001

ID
ZDB-TSCRIPT-090929-23377
Name
mir451a-001
Previous Names
  • mir451-001 (1)
Transcript Type
miRNA
Annotation Status
miRBASE
Associated With Genes
Strain
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Target Genes
Confirmed Targets
Sequence
MIMAT0001634 (1) [ Show ] (double-click sequence to select) [Download]
>lcl|MIMAT0001634|ZDB-TSCRIPT-090929-23377 LoadedMicroRNAMature mir451-001 miRNA 22bp
AAACCGTTACCATTACTGAGTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations