Transcript

mir7b-001

ID
ZDB-TSCRIPT-090929-23348
Name
mir7b-001
Previous Names
None
Transcript Type
miRNA
Annotation Status
miRBASE
Associated With Genes
Strain
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Target Genes
Confirmed Targets
Sequence
MIMAT0001265 (1) [ Show ] (double-click sequence to select) [Download]
>lcl|MIMAT0001265|ZDB-TSCRIPT-090929-23348 LoadedMicroRNAMature mir7b-001 miRNA 21bp
TGGAAGACTTGTGATTTTGTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations