header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-23347
Transcript Name: mef2ca-207
Previous Names: mef2ca-005, ottdart00000042757

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000042757 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000042757|OTTDARG00000030787|ZDB-GENE-980526-253 mef2ca|OTTDARP00000033940 mef2ca-005 LG_none CU462873.19,CU459206.8,CU469567.3,CU459205.5 Danio rerio protein_coding KNOWN, 393 bp
GAACGAAAGCCGGAGTCTTTACAGTGAGCGGAACGAGTGA
AGAGGAAAGACTGCGCTGAGGAACGACAGAGGAAGGAGAA
GGAGACGAGTGTGGACTGTACTTTTGGAAGAGGAAGGAAA
AAACAGACAGAAGTCATGGGGAGGAAAAAGATTCAGATTG
CGCGGATAATGGACGAACGCAACAGACAGGTTACGTTTAC
AAAGAGGAAGTTTGGACTGATGAAGAAGGCCTACGAGCTG
AGCGTATTGTGTGACTGTGAGATCGCCCTCATCATCTTCA
ACAGCACTAATAAACTCTTCCAGTACGCCAGCACGGACAT
GGACAAAGTTCTGCTGAAATACACCGAGTACAACGAGCCG
CACGAGAGTCGGACTAATTCAGACATCGTGGAG

mef2ca TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA mef2ca-201 3502
mef2ca-203 3567
mef2ca-204 6164
mef2ca-205 393
mef2ca-206 318
mef2ca-207 393
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mef2ca-207 Contained in:
OTHER mef2ca-207 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000042757 (1)
  • Ensembl_Trans:ENSDART00000138962 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC059188 (1) 4315bp
    CITATIONS (2)