Transcript

ppp1r2-201

ID
ZDB-TSCRIPT-090929-2269
Name
ppp1r2-201
Previous Names
  • ppp1r2-001
  • zgc:77285-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000012629 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000012629|OTTDARG00000010897|ZDB-GENE-040426-1814 ppp1r2|OTTDARP00000010847 ppp1r2-001 LG_ BX571973.15 Danio rerio protein_coding KNOWN, 1493 bp
GAAATCAAGTCCTCGTTTGCAAACTTTCCTCACAAACAGC
GTTTAACTTTCATCTAAAGCGGGCGACACAGCGTGTTCGG
TTAGAGGGTGGTTTCGGAGCCGCCACGGCGCGTTTCAGCC
GCTTGTTTGAGGCGTAAACAGTGTAAAACAGGAGTTGTGG
GTGGGTTTGACGGTTATGGCAGCACCGCGACCCATTAAAG
GCATTCTGAAGAACAAATCCAGTATTAAAGTCCGAGCAGA
AGAACCAGTTCAGGACATCCCAGAGCCCGGAGCCCCTCTA
AACTCTGAAGACGACCCTCAGAAAAAGTCACAGAAATGGG
ATGAAATGAACATTTTGGCCACATATCACCCGGCGGATAA
GGACTACGGGCTGATGAAGATTGACGAGCCCAGCACGCCA
TACCACAGGATGGTGGGCGATGAGGAGGACGAGGGGGCGC
TCAGCGATTCGGAGGGGAACACGGCGCTGCCCGGCGATGA
CCTCGCTCAGAAGCTGGCAGCAGCGGCGGCAGAGGGAGCG
GAGTCTCGCTTCATGCAGGAGCCAGAAGAGGAGAGCAGTG
AAGAAGAAGAAGAAGAGCTCAGTCCAGAGGAACAAGCAAG
AAAAAAGCAGTTCCAGATGATGAGGAAGATGCATTATAAT
GAAGGTATGAACATTAAACTGGCCCGGCAGCTGATCGCCA
ACGAGCTGGAGGAGGAGGATGAGGATGAAGATGAAGAGAT
GAAGGATGACACAGAGACTGAGGACATCACCGTCGACCCC
CCGCAAGATGCGGACTCGTTGGACTCCTAGAGATGTCCAG
ATTAGTCCTTCAGCTCCTGCCTTTTCTGATGAACCTCTGG
AAGGCGCAGAGTGTGTGTCGTCAGCGGTTCACCCTGTTTC
CACCAATGCCACGCATATCAACCAGCTCCCTTATTTGCCA
AAACGTTTATTGTTGTCACGCTAGGAAAAAAAGAGCGACT
CCTGGACTCCCGAGAGCGTTGGAGACTCGTGCAAACAACT
GCCAGGCCACTGTGAAGTGTGCTTGACCTTTGACCCCAGC
GCCGCTGTTCCCCATCTGCCCATCCACACACACATATACA
CATACGCTGTCTGTTTTCCCCGGCGCCGCTCATACTGACC
CGTTACAGACCCGAGTATTGTACTAGCAGGTGGTTTTACA
CTGGTAAAAGGGGACTGGTGTGGTCTTAAACCGCACACAT
GAGCTCTACTGTATGCATGGCTTCTATAAACCATGCTTAA
CTGCATTGGCACTAATCGTTTCTCCCCTGTGTATCCATTA
ATGGGCGATTATTACACTACTAGTGATAAAACTACTGATC
TGGTAGACTGAACCCAAAACTACAGCAGCTTTTCTGAAGC
TCTTTGTCTTGGTTAACTTGTTTTGATTGCCTTTTTTTGC
CATTATAATGCGGTTGTTTAATTCTTTTTCTTTTTTTTAA
TGAGGAATATAATTATCCTGTGGTACCAAATAAAATAAGA
AATCTTTTTGATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations