Community Action Needed: Please respond to the NIH RFI
Transcript

edn3b-201

ID
ZDB-TSCRIPT-090929-22280
Name
edn3b-201
Previous Names
  • edn3-001
  • edn3b-001
  • si:dkey-211h10.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000042579 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042579|OTTDARG00000030687|ZDB-GENE-090313-235 edn3b|OTTDARP00000033837 DKEY-211H10.1-001 LG_ AL929345.15 Danio rerio protein_coding NOVEL, 1267 bp
AAAAAGTCTTTTCCAACAGGGTTGTTTTCAGATTTTGATG
AGGATGCTCAGAACTATTTTTTTTGACTGAAATGGATTTG
TTTTGGAAAACATTTTTCATTTAGAAACCCGGAAACCGCA
TCTGACAACTTTTTTCCCCCCACAAATTGGTCTCGAGCAC
AATAATAAGGACGCTATTAAAATGGCTAAACTGATTCCTG
ATGCACTTTTGCTAATTGTGAGTTTGATAAACATTTTCAC
CGTGGATACATCGTTTTCCAGTGAGGGAGACTTGCACTCA
TCTCCAGTCTTCTCTGGTGGTTCCAGCAGTGTTGGACATC
AGCAGAAAGAAGCGAAGCTTGTTTCAGCATCACACGCTCA
CACAAGATCCAAGCGCTGCACTTGCTACTCTTTCAAAGAC
AGAGAATGTGTTTATTACTGTCATTTGGGCATCATCTGGA
TCAACACCCCACAACGTACAGTTCCATACGGCATGTCAAG
TTATCGCAGCCCTCAGAGATTAAGGCGCTCCAGCGGGACT
ATATCAGTGGTTCTTCGTCGCTGCTTATGCACAGACCATA
ATGATGTCCATTGCTACAACTTCTGTGATGCAAGCTCCGA
GAATGTGTCAGAGGGAAGATTGAGAGGACGTTCACCTTGG
TAAGACCACTGGCTTCTTGTCACACCTCCAGCCTCAGAAA
TCAGGACTGATGATCAGCATCAAACCGGGCATCTAACTAG
GTACAGGTTTTGGATTTTTACAGATTTGGAGTAAAAGCTA
CCCCACATTCCTCAGCGTGTTATATTTCCTGGAACGTCCT
TGACTCATCTGGTCCACGGTAACAAGTGAATTCCTTAGAA
AACTCTTTGCAGATTTCGGAAGCATATCTGTGTGGGACGC
ACGTCCTTGCTTCAAGGGTTACGTCCAGTTGACTTTACAT
TGACATTTTAACAAATGCGAATACTCAGTGGACGTCCTTG
GATTCGGGAGCCTTGCAGGTCTGGAATCAGATCTTTAAAA
TACTCTATGCATTATCTCCACTTTGTGGGCAGATTTTCAG
ACGGATAAAGTGAGTCTTGAATTCTTCACTTTGCCTGATT
GCAGAAAATAATATGTTCAATGTTGTTATTGTGAATGAAC
TGAGAAAAAAAAGTTTCCTGAGAGAAAGATTGCCAGATTA
ACCGCTACAATTTTTTTTTAACCTCCTAAACATATCCTTT
CTGATTTTGCTCACTCAAGCAAAATGTTTTTCCTCTGCAC
AACAAGTTTTGACATTTTATTTTCTCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations