Transcript

tac3a-201

ID
ZDB-TSCRIPT-090929-22265
Name
tac3a-201
Previous Names
  • tac3a-001
  • si:dkey-228g21.4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000042563 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042563|OTTDARG00000030678|ZDB-GENE-090313-253 tac3a|OTTDARP00000033828 DKEY-228G21.4-001 LG_ BX663515.13 Danio rerio protein_coding PUTATIVE, 710 bp
CGCACATGTTGCTATCATTTAACAATCAGACAGGAGAGAA
TCCCTGTCTCTGTGTCTTGTCTGATAGATAGTCCATCACA
AAAGGATTTAACTCTCCAAGCAGAAACTGGAACTGAGCTC
TTTTCTACAGATCTTCATCCTCAGCTCAGAATAATCTGTA
AAGATGTACCGTGGACTTGTGTTACTGTTCTTGGTTTTGG
TGCTGGAAACCCGATGGAGTGAGTCGAGCTGTCAGCAGTC
AGAGTCTCAAAGATCAGTTTCAAGCGAGAGTCCAAGTTTT
CGGATGTCGACTCATAACTTGCTGAAGAGGTATAATGACA
TAGATTATGACAGTTTCGTCGGATTAATGGGGCGCAGAAA
CGCCGAAACAGATGATATACCACCCCAACGTAAAAGGGAA
ATGCACGATATCTTTGTTGGACTCATGGGTCGACGAAGCG
CTGAACCTGAATCCGGACGTCAATGGAGGAAAGAGTACCC
AGAACCAAGCGGAGGAATCTTCTTTAACAAATGCAAACTG
AGGTTTCGTCGTGGGTTATAGGCAAAAAAATATTTCATAT
CCACTAAATCGTCTGCACCACCCTGTCACGACAGCTTCTT
TTCAATAAACTTCTTTGGAGCAACAACAAGAAGTTATAAT
CTATTTTACAAAAGTGATAGAGCAACAGCAATTTATACAA
GATGAATCTAATAAACATGATTTCCTATGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations