Transcript

cacnb3b-201

ID
ZDB-TSCRIPT-090929-22016
Name
cacnb3b-201
Previous Names
  • cacnb3b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000042283 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042283|OTTDARG00000030521|ZDB-GENE-090127-1 cacnb3b|OTTDARP00000033641 cacnb3b-001 LG_ CT573349.6 Danio rerio protein_coding KNOWN, 1128 bp
AGTTCAGCAGATTCCTACACAAGTCGACCATCGGATTCCG
ACCTGTCCCTGGAGGAGGACAAGGAGGCGTCTCGGCGTGA
GGCCGAGCGCCAGGCACTGCTCCAGCTCGAGAGGGCCAAG
ACCAAACCTGTGGCATTTGCAGTAAGAACCAATGTCAGCT
ACTGTGGGGCTCTCGATGAAGACTGTCCGGTTCAGGGTGC
TGCCATCAACTTTGAAACCAAAGATTTTCTACATATAAAG
GAGAAGTATAATAATGACTGGTGGATCGGGAGGCTGGTGA
AGGAGGGGGCAGATATTGCCTTCATCCCCAGCCCTGTTAA
ACTGGAGGCCATGCGGATCAAGCAGGAACAGAAAGCAGCT
CAGAGGAAAATGGGCAATGCGTCATCTGGGGGCTGGAGAT
CCACTCCTCCCTCTGCAGCCAAACAGAAGCAGAAGCAGAC
TGAGCATGTTCCTCCCTATGATGTGGTTCCATCCATGAGG
CCTGTTGTTCTGGTTGGCCCCTCGTTAAAAGGATATGAGG
TGACTGATATGATGCAGAAAGCCTTGTTTGACTTCCTGAA
ACACAGGTTTGATGGAAGGATTTCTATCACCCGGGTGACT
GCAGATCTGTCTCTGGCCAAAAGATCTGTTCTGAACAAGA
AAGCGATCATGGAAAGGTCTAACACACGCTCCAGTCTGGC
GGAGGTGCAGAGTGAGATTGAGAGAATATTTGAGCTGGCT
AAGAGTTTGCAGTTGGTGGTCTTGGATGCTGACACGATCA
ACCATCCCGCACAACTACTCAAGACTTCCCTCGCCCCCAT
CATCGTCTACGTCAAAGTGTCCTCTCCAAAGGTCCTTCAA
AGACTCATTAAGTCCAGAGGGAAATCTCAAAGCAAACATC
TCAACGTCCAGATGATGGCAGGAGATAAACTGGCACAGTG
TCCACCGGAAATGTTTGATGTTATACTGGATGAGAATCAG
CTGGAGGATGCGTGTGAGCACTTGGCTGAATATTTAGATA
TATACTGGCGCGCCACTCATCTGCCAGGCTCCGCTCCGCT
GAACCCGCTGGTGGAGCAGAATGTGGTCACACCTCCCTCT
GCCAACTCCAGCCAACAGTTCTCAGAGACGCAGGAGCTTA
TTGAATGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations