Transcript

nol9-202

ID
ZDB-TSCRIPT-090929-21933
Name
nol9-202
Previous Names
  • nol9-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000042195 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042195|OTTDARG00000030464|ZDB-GENE-070629-1 nol9|OTTDARP00000033589 nol9-001 LG_ CR376748.8 Danio rerio protein_coding KNOWN, 2897 bp
TGTTGTCCAGTAGACGGCTGTGAGCGCACATCGCTGCACG
AAATTGTTCTCGTTAGCCACAGAGTATCTTTAACATATTT
ATGCTTCGTCTCACATATGCATCAGAAAGTGATAATGCAG
TATTAAAGCTGATCAAAATAAATAACTAGGTCTCGATTAG
TGAAGAGGATCTCCAACAGCATCGTGCAGCGTGATATCTG
TTCACATGGAGAGTGGCACTTACACAGAAACTACAGCAGC
TTAACTGAAACTCTTATATTACGTGTTTTACGTCTTTGTT
TGTTCTCAAGTCTGGTTTATCATCGGCTACAGCGGATTCT
CACTTTAAACAGGTGTTTCCTAGCTCTGGATTTATGTCGT
TTATAGTCTCGTTGGGGGTCAGCGGATGACAATGAAAGTA
CACAAGGTTCATTCTCGGTCCCAACAGAGGCAGCGAAATG
CATCTAAACAACATGGCAAGAATAAGTGGAACAAAAAAGT
GCGCAGCCTGGACTCAACGCTCCTTAATACCAGCTCAGGA
ACTGCAAAGTTGGAACAAGAGATAGCCAAAAAGGAGAAAC
CAGCAATAAAACGGTTGAAGAAGTTGTATGCGAAGCCTGT
GACTCTTCTCTCTGATAACAACTGTGCAGACGAGGATAAA
GTTAAACCCACTTCTGTGACTTTTGCTCATGTCCACACAA
ATGGAGGCACAGAACTGGATGACAGCAGCAGATCAGTGGA
CTCACAAGAATGGAGTGAATATGCCAACAGTGTTCTTCAG
AACGGCATGGAGACTTCAACATTACCTGACTCAGACCAGG
CGGAGGATGGGCTTCAATTCCATGCCCACCTTGATCATAC
CAAGAACCGTGCAGTGTTAGTCATGAAACAAAGTCAGGTC
TTGTGTTTTCGTGGGAAGTGCCTGCTCACTTGCCTCTATG
GTCATGTAGAAGTGCTGGGCTTCACCATAGAGGAGGGTCA
ACAGCCTTACCCTGTGTTTTCACCACCGACCCACTGCCCG
CTCACTATCACGGCCTTAGGAAACAACCAGTCCTCCAGCA
AGAACAAGAAAGAGGGCCAGCTGGAAGCAAAAGCCATTGT
TCGCAAATATTTCACAACAGAGCCGAGTAAAAAGCTGATG
AATGAGGTGGATTCGGATTCCTGTGTGGTGCTTCTGGAGT
CTCTGGACACACCACTCACTCGCTTTCTCTCCAGCTTTTC
TGAACTCACTGAGCTATTCGGCCTCAACTCGAAGGAGTTG
AAGTCTCAGGCTGCCATCTATAGCCCTGTCCTGTCCGCTG
TGGGTGTAACGGCTCTGCGTGGGCCTTGTGCACAGGGTCT
GGTCATGTCACGCAGCTACAAAGAAACTATAAGCAGTTTG
CTCAGTGCCTGGGCAGGGGAATTCGACCGTTGTCCCATAA
TTCTTGTGTGTGGAGGCAAATCTTCTGGCAAGTCCACCTT
TAATCGGCACCTAATCAACAGCCTGCTAAATCATACTGCG
AGTGTGGAGTATTTGGAGTGTGATTTGGGCCAGACTGAGT
TCACCCCTCCTGGATGTCTTTCCTTGTGCACAGTTACAGA
ACCACTGCTTGGGCCTCCTTTCACACACCTGCGTGACCCA
GAGCACATGGTGTATTACGGTCAGGCAGATTGTCAGTCTG
ACATCGATCGATATCTGGAGTCCCTCAAATCCCTCTGGCG
CAACGTCAGTGGAGAGAGTCCTGTTATCATCAATACTATG
GGCTGGATCAGAGGTCATGGCTTTCAGATACTGGTGGACC
TCGTCCGTCTGTTTTCAGTCACTCACGTGGTTCAGCTGAG
TTATGGGACAGCGCCACAATGTCAGCTGCTCACCTCAGAG
TTCATCAGAAGTGCCCACGGCTGGCAGACTCACCCTCCAA
CAACCCCTGCCTTGACTGAGGACAGTCACTCCCCCAGCCG
ATCACATGTGTTTCTCAGCGTTCAGTCAGAGTTTGAGGGT
GCTGGGGTATCTGGTGAAATGCGTTTTCAGCGCAGTAATG
AGCTGCGAGACCTGGCTCTCCTCAGCTATATCAGCAAGCT
GCAGTCCTCAGATCCAGGCCCCATCCGGCCTCTACACTGC
TTCATACCATATCAGGTCCCACACTCATCAGTAGCTATAG
GTGTCACACACTGTGAAGTCGCACCCAACAACATCCTCTA
TGCGGCCAATGCCAGTGTAGTAGGATTGTGCTGTCTGAGT
GAAAAGGTTGTGGGCAGAGGAGGTCCTGTTATCCTCTCCC
AAACGCCCATCTGTCAATGCGTGGGCCTAGGTGTTCTGCG
AGGGGTGGACATGGGACGAGGGCTGTATTTTCTGGTTACT
CCAGTGTCTCCATCTGTCCTGAAGCATGTGAATTGTCTTT
TGCTGGGAGAGATCAGTCTGCCCAAAATATTGCTGACCCA
GCAGCATGGAGTTGAAGGAGATTTACCTTACATTACCACA
GATTACAGCTTTGAGGTGCAAGGCGCAGGAAAGCTCCACA
TCTTCAAAGGACTAACAAGACCTGGTTTTATAAAGTCTGA
TAACTAAGCTCTTCTCTACGGACTCTACTTTTTGTGAATG
ACATTTCTATCCTTGTGTTTGTTTTATACCCAACATATTG
AGGAACATTTTGCCATTAAATGTACAAATCTACACCAGTA
TCTTGGCTTTCAGAACAGTATACTGTGGAGAGATGGAATG
TATGAAATGATTTGTGGTTTCTTTATCCCATGCTGAACGG
CTCCGATTTTAAGATCCTTGAGTTTTGAAAGTCTTGTTTT
GATTTGCTGTACTGTTACAGTTTGTCAAATGGTTATGAAA
AGGTCATTGAGAGTTTCTGTTTCCTCTTGTCCCATTTCCA
ATCCGAGATCATTCAGACTGTAAAATATTAAAGGTTTGCT
TCATTTTTGTCAAGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations