Transcript

klhl17-202

ID
ZDB-TSCRIPT-090929-21842
Name
klhl17-202
Previous Names
  • klhl17-001
  • si:dkey-98j1.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000042096 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042096|OTTDARG00000030397|ZDB-GENE-030131-8131 klhl17|OTTDARP00000033521 DKEY-98J1.3-001 LG_ AL845437.14 Danio rerio protein_coding NOVEL, 4135 bp
GATCAGAGCTGAGACAGTCGTCTGTTTTGATGCGACATGT
GATGTAGCATGTCAACTCATCACGAACGGCTTAATAAATC
ACCACATGCATCAGAATTAATCACAAAACACGGACAAAAC
TGGAGAGAGCGCTACACAGAAAGAAACGAGTCTTGTCAGT
CAGACACAGACGGCGGCAGCATTTTAGAGTGAGGCCCAGG
CTCCAGCTGGCCTTGGAGAGCACCGGCATGATGGAGGGAG
GTATGCAGCTGCTGAACCGGGATGGCCACAGCATCTCGCA
CAACTCCAAGCGCCACTACCACGACTCCTTCGTGTCCATG
AACCGCATGCGGCAGCGTGGCCTGCTCTGCGATATCGTAC
TCCATGTGGCCAACAAGGAGATTAAGGCGCACAAGGTGGT
GCTGGCCTCCTGCAGTCCATACTTCCATGCCATGTTTACA
AATGAGATGTCAGAGAGTCGTCAGACCCATGTGACCCTGC
ATGACATTGACCCTCAGGCTCTGGAGCAGCTGGTGCAGTA
CGCTTACACCGCTGAGATCGTAGTAGGAGAAGGCAATGTG
CAGACCCTGTTGCCGGCAGCAAGTCTTCTGCAGCTCAATG
GAGTGAGAGATGCCTGCTGTAAATTCCTCCTCAGCCAGCT
GGACCCCTCAAACTGCCTGGGCATCCGCGGCTTTGCAGAC
ACTCACTCCTGCAGCGACCTTCTTAAGTCAGCTCATAAGT
ACGTCCTGCAGCACTTTGTAGAGGTATCCAAAACTGAGGA
GTTCATGCTGCTGCCTCTCAAACAGGTGCTGGATCTGATC
TCTAGCGATAACCTGAATGTCCCATCAGAGGAGGAGGTGT
ACAGGGCTGTGCTGAGCTGGGTCAAGCATGACATTGATGG
GCGGAGGCAACACGTGCCGCGGCTGATGAAGTGTGTGCGT
CTGCCCCTGCTTACACGGGACTTCCTGATGAGTAACGTGG
ATACGGAGCTGCTGGTACGTCACCACTCTGAGTGCAAAGA
CCTGCTGATCGAGGCGCTGAAGTATCACCTGATGCCCGAG
CAGAGGGGTGTGCTCAGTAACAGTCGTACACGACCACGCC
GCTGCGAAGGAGCCAGCCCAGTTCTGTTTGCCGTAGGTGG
GGGCAGTCTTTTTGCTATTCATGGAGACTGTGAGGCCTAT
GATACCAGGACAGACCGCTGGCACATGGTTGCATCCATGT
CAACACGGCGGGCTCGAGTCGGAGTGGCCGCCATTGGAAA
CAAGCTCTATGCTGTGGGCGGGTATGATGGCACTTCGGAT
TTGGCAACTGTAGAGTCGTATGACCCAGTCACTAATGCGT
GGCAACCTGAGGTGTCCATGGGAACGAGGAGGAGCTGTTT
AGGTGTGGCGGTTCTGCATGGGCTGCTGTATGCGGCAGGA
GGATATGATGGTGCTTCCTGTCTCAACAGTGCAGAAAGGT
ATGACCCACTGACCAGTACCTGGACCTCCATCGCTGCCAT
GAGCACCAGGAGGAGATATGTCCGAGTGGCCACATTAGAT
GGCAGTTTGTATGCAGTCGGTGGGTACGACAGCTCTTCAC
ACTTAGCAACAGTAGAAAAATACGACCCTCAGAGTAATGC
ATGGACTGCCATTGCCAACATGTTAAGCAGGAGAAGCAGT
GCAGGAGTGGCTGTACTGGAAGGCATGCTTTATGTTGCGG
GTGGCAATGATGGTACCAGCTGCCTAAATTCGGTGGAACG
ATACAATCCCAAAACCAACACGTGGGAAGGAGTGGCTCCT
ATGAACATCCGCAGGAGCACCCATGACCTGGTCGCCATGG
ACGGATGGCTATACGCAGTCGGAGGAAACGATGGCAGCTC
TAGCCTCAATTCCATAGAAAAGTACAACCCTCGTAGCAAC
AAGTGGGTGGCAGCGTCATGCATGTTCACACGCCGTAGCA
GCGTTGGAGTCGCTGTTCTGGAGCTCCTCAACTTTCCTCC
TCCATCCTCTCCCACTCTTTCCGTCTCCTCCACTAGTCTT
TGACAAAGGGTAAAAACCCGGCTTAGCTCAAGCGGCCTGC
CTTGTGTGGCCAAGAGGCGCAACTGCTCGGTTTGAGCACC
AAACGAGGAGTGTTTTGTGGGCCACAGCGCCCTCCCTCTG
CCTGGAGGATTACTGCAGATGGTTAAAAAAAGGATGAAAA
GGAAAAATCACACTCTTACACGCCTCCACGACTGTCACCC
TGTAAACCCTAGTGCTTGAAAGTGCAAAGTCATGTTGCTC
TGCCATTTTGCGGTCACTTTGTGTAAAATATATACCTAAA
TGTACATTTAATTTATGTTTACATTTTTCTTTTTGAAGAA
ATAATATATTAAACACGAAAAAAAAAAACAACTTTAGGAA
TGTAGCTCTCGACAGGTTCTGCCATGCATGTTTACAAAAA
TTTCGTCCTGGCAGAAAATAATATTGTAGTGCTGCTGTGC
CACACTAGGTGGCAGTAACGTGCAATGCTGCCCTTTCTCA
CCACAGACGCGCATGGACATTTTAGAAGCAGAAAATTCTC
ACAGAAACATGCGAATTCTACACTACGTACACCTGAGTGT
GCTCAGATCATGTTGACAACATAATATATGTTTTATGTAT
TTTAATATTTATTTATCAATTGTAATATAAACATATGACA
CTATTTCAGAGATGTTTGAAGGACCACCTCTGACTGAAGA
GGAGATATATAGTTTTCACATACAAATGAACATACTTATT
GCATATCAGAGAAGCACTGGTGTTTGGTATGAAATGTGGG
AGAAGAGGTGTTTAGTGTTTTATCTAAGAGACATGCTCGG
TTTGTTTTCTAAAGTCATGTATTACAAGCCTTTTAGAGTT
TGGGACTCTACTAATATGACACGTCTATTTCACTAACCAG
GAGAAATGTCAAACCAAGACTATATAGCCATACTTAAAAA
AAACTAGCTGTGACATTAAAGCTGCACTTTCTCTTTTTTT
GTGGTTTAAAACGGGCGATTGGTGCTCAGAACTAATCCTG
ATTAAGTGATTAGTAATACTGACACTTCAAAATAAAGCCC
TTCAATGTGAGTAACTCGGATACTATAAGCTCCTGTATGT
TGTACGTCACAGTATTTTTGCTTTAAGTCTTTAGTTACGT
TTCCAAGGTTGATCACATTGTCATTGTATATTGCATTTTA
TAACTTTTATTGCTCATTTGCCAGGGTTGTCAGCTTTGAC
AGCTTGATCAGATCTAGATGGTATGTGTTGTGCAGTGATG
TCATTGGTAATAGCCACTACTAATGCATCTTACTTCAGAT
GGGAAGTTGAGTGAACACTGGGTTTGGTGAGTGATTGTTT
TTAACTGATGAGAGCGCGGAGAACAAGGGATTTTTCACAC
AAAAATTAAAATGTATTTATTTATTTATTTTAATTACTTT
TCGCTACGTTGTCCCGAACATGTACGACATTGTTTATGAA
CACAACTGATATTAGAAGAAAGCCTAAGCTGTTATGGTTA
AACAGTTAATGGGGGTCAGTCGTATGGGAAAGGATCAGCT
TGAACATTCTGCTAAATATCTTTTATATTTTACAGGAAAA
AGTCATATATGGTTTGGAAGAAGGTTTAATTTTTGTGTGA
TCGATCCTTTAAATTCAGTTCTGCTCTCTGCCATTTTACT
TAGGTTTTAAAATGTAGTATTATATGATTTCAAAACTTCT
GAGAAGTTAGGATTTTATTTCCTTTTTTTTAAGGACTTTG
TTAATTCAGAGAAACGTGTTTAAGGTCAGTATGAGTTTGC
GTCCAGGGAGATCAGAGTGCTCTGTATGTGTGTTTCTGTA
GAAGTGGAACATCCTGCACTTTGACAATGACTGAATATAT
ACATGCATAACACACACCGCAGGACCACATCCCCACAGAA
ATCAATTACAGTATGTATATAACCAAATATCCTGAAACTT
TGTGCAATGTCTATGTAATCGTGGCTTTTTTTCTTTTGTC
CTTTTTTCCCCCGATCGTAATGTTGTTGAATGTGTTATTT
ATATTGTGTTGGTTATGTTTTGCTATATTTAAAAACAAAC
ATGAATTTTTGCACTACAGTCAAATGGAGCAATATACTGC
TGTTTAAAATGAAAACACACTACTGTAAATGAAATAAAGC
TGTTTTCATGTGGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations