Transcript

adamtsl7-201

ID
ZDB-TSCRIPT-090929-21684
Name
adamtsl7-201
Previous Names
  • adamtsl7-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000041857 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000041857|OTTDARG00000030257|ZDB-GENE-070816-2 adamtsl7|OTTDARP00000033378 DKEY-251E24.5-001 LG_ BX284619.11 Danio rerio protein_coding NOVEL, 2226 bp
ACACAAACACACATCTCTATTCAGAGACAGCTCTACTGCA
GTGTTTCTCACTGACACACACACACACACATATCATATTA
ACTGCTTTATTCTGCTCATGGCTTGTGATAGCGGACACCG
GTGGAGACTCATCCTGCATTTCCTCCAGATGACCCTCCTG
CTCTTCTTCCTCTGCCCACCCACAGAGCCTGCTCCCTGGG
ACAGCGACTCCAGCAGCGGCCCTGGAGAGGGCTGTGAGGG
TTTCCAGGTGGATGTGTGTGGTGTGTGTGCTGGAGACGGG
AGCTCGTGTGAACTGTTCAATGGGACAATCTTTCTCTCTG
TGCTCTCGGTTAGATACCACAAGATCCTGGATATCCCCTC
TGGAGCTCTGCGAATAAAAATACAGGAAACACACAAGACC
AGGAACTATTTGGCTCTCAGCATGGCAACTGGTGAATCGG
TGATAAATGGTGACTGGGTGATCGACAGGCCAGGACAGTT
TTACGCCGCAGGCACTCAGTTCACATACAAGCGGCCCAAT
GAGATACGCAGCAGAGCAGGAGAATCCATCACTGCACCTG
GACCCACCAATCAGGAGCTGAATCTCTTTGTGATTTACCA
ACAGCCTGATGCAGCAGTGTATTATGAATATATTCTACCC
AAACACACTAACACTCATTCAGATGCATATTCTTACTCTA
GCGTACTTCCTCTAGTCGAGAGTCATGGAATATTTCCTGA
TTCTGAAAACAGTGTTGGTGAAAACTCATTGAGCAGCTTT
CACCCTAACCAAGTCCCATCAGACTCAGTAACCCTTGAAC
CAGTGCCTCTGTACAGCTGGATGGCAATGGCCACAACACC
CTGCAGTACCACCTGTGGAACAGGCAATCGTCAGGTTCTG
TTTGGCTGTGTGGAAAGGGCCACTCAAACCACTGTACTAG
AGGATCTGTGCAGCTCCATCACTCATCCTGGACCTCAGGT
TGAAGAGTGTCAGTCACAGCCTTGTCCTGCTTTTTGGGAT
GTTGGTGAATGGTCTGAGTGCAGTAAGACTTGTGGTCCAG
GTTTCCAGTATCGTCAGGTGATTTGCCGGCAAACACAGGG
ACAGCATGGCAGTAGTACAGTGGTGGTGGCGAACAGCATG
TGTGACGACACAGAGATGCCAGATACCACCAGCGTCTGCC
AGCTCAAGATCTGCAGTGAGTGGCAGATCCGCTCCGAGTG
GACTGAGTGCTCTGTGCCGTGTGGTGTCGGTCAGCGCAGT
AGAGAAGTGGTGTGTGTGGATAACCTGGGTGATATTGTTT
CTGACGAGGAATGCAACATGGCCCTTCGCCCGCAGGATCT
GCAGAACTGTGACAAAGGAGTGTGTGCCAGCAGCTGGTTC
TACTCTCTCTGGAGTGAAAGGTGTTCTGCAGACTGTGCTG
AAGGCAGTCGCAGCCGGTCGGTGGTGTGTTTGATGAGCCA
AAGTAACTCTCTGCCGCTGGACGACTGTGATGATGAGGAC
AAACCCGATGAGCTCATGCAGTGTGACCTGGGACCCTGCA
CACAGAGACTGGAGTGGTACACAGGGCCTTGGGGACAGTG
CTCATCTGAATGTGGCAATGGTACCCAGAGTCGTGGTGTG
GTCTGTGTTGTCCAAAACGGTGGTCATTTAGAAGTGACCT
CAGATGACCTCTGCTCTCATCTGCCTCGTCCTCCAACTGC
ACAGAGCTGCTATTTGAAGAGCTGTGCGGCGCAGTGGTTC
ATGACTGAGTGGAGCTCGTGTTCCCGCTCTTGTGAAGGAG
GCTTTCGAGTGAGGGAGGTACGGTGTTTACGAGATGACCT
GACATCAAGTCATGACTGTGATCCTGCCCTTGAACCTGCA
AAACAGGAGAAATGTAACACACACATCTGCACACTACAGA
TCGACGAGTCCTGCAGAGACATGTACTATAACTGTGTGGT
GGTGGTCCAGGCACGTTTGTGTGTTTACTCATACTATCGC
ACCACATGCTGCGCGTCCTGCTCTCGGGTCATTCAGAGAG
ACTCGCTGCATACAATCAGGTGATCTGCCTGCTTTTCAGG
ACGTGGCATCATTTTCAGCTGGATCTGACCCGGAGAGGAC
ATCACTGCTCATCTCCTCTCTGCCGTATTCTTCAAGACAA
GTATACATTCAAGACGTATACATTCACTGCCCCTCTTTTT
ACAGCTGCAATTTAAGAATGCTCCATGAGCAACTGAATAT
TTATTGCAAATAAAACCAACTGAGCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations