Transcript

apela-201

ID
ZDB-TSCRIPT-090929-21583
Name
apela-201
Previous Names
  • apela-002
  • si:ch211-42i9.4-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000041726 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000041726|OTTDARG00000030180|ZDB-GENE-090313-116 apela|OTTDARP00000047535 apela-002 LG_ BX323590.9 Danio rerio protein_coding KNOWN, 748 bp
ATCTGTCTATCTATCCATCCCTCAGAGGACAGAGAGAGAA
GAGAGAGTGAATATCGCCCTCTCAAACTTTGAAAAAGTTG
GAGAGACCGAGAGCTGGCTACAACTGCGTGTCTTCTATAT
AACTCAACTTATATGAGATCTGAGAACACTTGCTGAGAGC
GACAGACACATAAGAGGATTTCTACAGTCCGTTACCTGCA
CATCCGACAGAATTTATCGTCTGAGGAACCGCGGACATCC
TGTGAGGAGAGTCGAGTCTGCGCCGCGGACCAAACCACCC
TGAGCATCACCATGAGATTCTTCCACCCGCTGTATCTGCT
GCTGCTGCTGCTGACAGTGCTGGTCCTCATCAGCGCAGAT
AAACATGGTACAAAACACGGTTTTATGATGCTCCGGGCAA
GCATTAAGAAAAACCAAAGACCAGCCTTGGATTGGAAATG
AGAGAAGATTTATGTCAGATGTGCCGAGGACTGTTTTATT
CGCACATGTATTGTAATCAAAGCCATGTTTGTCTCTTCTG
TAGCAGAAGTGTTTTTTGTTTTGTTTTGTTTTTTAAATGA
ATGTAAGTGAATGAGCCATGGAGATCCTACTGCTGCCAAA
CATGCTGCAAACTCATCACTCAATCAGGTTGAGTTGGAGC
AGAATCATTGTAAATAGTAAGGACTGAATGAAATGTGTTT
ATATGTAAGTTATGCACTTCAAATGTTTTATTATTATCTT
GATTTATTAAAAGTGTATTGTCTTTTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations