Transcript

si:dkey-37g12.2p-001

ID
ZDB-TSCRIPT-090929-21532
Name
si:dkey-37g12.2p-001
Previous Names
None
Transcript Type
pseudogenic transcript
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000041485 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000041485|OTTDARG00000030087|ZDB-GENE-090313-309 si:dkey-37g12.2|no_translation DKEY-37G12.2-001 LG_ CR392347.5 Danio rerio processed_pseudogene none, 1002 bp
ACCACTAGGTTGAACAGCATGGAAAACACCTCAGAATGGA
GCAACAATTCACTGGACTCGGATTTTGAAGCTTGTGCCAC
ATTGAGGAGCTTTGGTTCACGAGTCGCCCTCTATCTCTTC
ATCATCACAGGGATCCTCTGCACCGTGGTGGGAAACTTCC
TGGTGGTTCTCGCCATTGCGTACTTCAAACAGCTGCAGTG
CCCTACTAACTCTTTCGTCATGTCTCTAGCAGTCGCTGAC
TTTCTTGTGGGCCTGGTGGTCATGCCTTACAGTATGGTCA
GAACAGTTGAAGGATGTTGGTATTTCGGCCCAACCTTCTG
CCATCTTCACTCCAGCTTGGATGTTATGCTCTGCACAGCC
TCCATTTTCCACCTGAGCTGCATTGCTTTTGACCGCTACT
ATGCTGTCTGCAACCCACTGGTGTATTCCTTTAAGATGTC
TCGCAAGCGCGTTGGTTTGCTGATTGTGGTTTGCTGGGCC
ATTCCTTTTCTCATATCATTTGGTCCTATTCTCTTCGGGC
TGCACAAGCTTGGTGTGGATATTCCTTTACCTGAGAACAT
GTGCGTCTTCTTAGTGAACCGTATTTATGCCGTGATGGCG
TCGCTTGTTGCGTTTTACCTGCCTATGGTGACCATGTTGG
TGGCCTATTGGAAGATCTACAAAGCAGCCAAACGGCAAGC
CATGCAGATCAGCGCGATGGAGGCACAGATGGCAGCAGGT
GTGGGCAAAGACTCGAGTAAGAAACAAAAACATCGCAACT
CCATAAGGAGAGAGAGAAAAGCTGCCAAAACGCTAGGGAT
CATCATGGGGGTTTTCCTTCTTTTCTGGCTGCCCTTCTTC
ACTGTTAATATCATTGACCCATTCATCGAGTATGGGACAG
CGGTTGTGATATGGGATGTTTTTCTGTGGTTGGGGTACAT
TAACTCCTCGCTAAATCCTTTTCTCTATGGCTTCTTCAAC
CGGTCGTTTCGGCGAGCTTTCCTCATGATCATGGGATGCA
GA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations