Transcript

phox2ba-201

ID
ZDB-TSCRIPT-090929-21458
Name
phox2ba-201
Previous Names
  • phox2ba-001
  • si:ch211-157h5.5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000041406 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000041406|OTTDARG00000030036|ZDB-GENE-090313-51 phox2ba|OTTDARP00000033074 CH211-157H5.5-001 LG_ BX323984.7 Danio rerio protein_coding KNOWN, 872 bp
TAGCTAATAAAAGCAACTGAGCTCCAACATAAAAACTGGT
CGGAGATCGGCACCACAGAGACTTCGCGAGTTTATGATGG
AGTACAGCTATCTGACGTCTCCTGCGTATGAGTCCGGGAT
GGAAACCGGCAGATCCTCGAGCCGTTCGGCGGACTTCAGC
TCCTGCACTCCTTCACTTTCCAATACAACAGGTGCAATTT
AGGAAACGCCAGCTGCCATTTCCTCTCGCCCGGATCTCAC
CAAACTTCCCACTACATAACAGTGCATTCTAATCTTATGG
CTTATGAACGAGGCGTCCAGGAGCGGCGCAAACAAAGGCG
CGTGCGCACCATCTTCACCAGCGCGCAGCTGAAAGCGCTC
GAGCGCGCCTTCGCACACACTCAATATCCGGACATCTACA
CGAGAGAGGAGCTCGTGCAGGAGATCCAGCTCACTGAAGC
CCGAGTTCAGGTCTGGTTTCAGAACAGACGTGCTAAATTC
CGCAAACAGGAGCGCGCAGCCTCATGGAATGAGTCTTCCT
CAAAAACACACAGTTCACCATCTCATGACAGCTCAGAAAC
AGCGAGCGCCACTGACCCAGACAGCACACAGCCCTCTCTT
CCCCTCATTGGGGACCAGAAGCAGGACAGCAGAGACAGAC
CACCTCCAGAGGAGCTGCCTCTGTTGTTAGGCTTAACTTC
TCTTGAAGCACAGAGACAGCGTGGTCATCAAATTCCCTGT
GTTGATTCTGTGTGCCTGTGTTGAACACTGAAGACATGAT
GTGCCATTTAAAACACTGAATACATTAGTTAGTGTCAGTT
TCTAACTTTTATTTTTGTTTTATCTTAACAAGTCTCTGAG
GGATTTAATATAGTAATAAATATATATGGCAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations