Transcript

zgc:153642-201

ID
ZDB-TSCRIPT-090929-21368
Name
zgc:153642-201
Previous Names
  • zgc:153642-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000041303 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000041303|OTTDARG00000029969|ZDB-GENE-061013-527 zgc:153642|OTTDARP00000032992 CH1073-501A1.2-001 LG_ CU550714.4 Danio rerio protein_coding KNOWN, 1370 bp
AGATGTCCTGAAATCCTTGAAGAAGCAAGTCAAACATGCA
GAGAAGCTATTACAGCACCATGGATCCTGAGATACGCATT
GTTTTAGTTGGTAAAACAGGAGTCGGAAAGAGCGCTACAG
GAAACACCATTCTTGGCGAAAAAGCTTTCAATTCAGAAGC
AAGAGCAACATCCATCACTAAAGAATGCTCACGTGAATCA
CGGATGATAGACAGAAAGCAGGTTTCGATTGTGGACACTC
CTGGGCTTTATGATACTCACCTGTCCAATGAACAAGTCAT
AACTGAAGTTGTGAACTGCATTAGACTTGCGACTCCAGGT
CCTCATGTCTTTCTTCTCATAATTGCCATCGGACGCTTTA
CTAAAGAGGAGAAGAAAACTGTTGAACTCATTCAGAAAGT
CTTTGGGCAGCAAGTGCACAGACACATGATGATTTTATTC
ACCAGAGCTGATGATCTTGAAGACAGGACACTGGAGGATT
TCATTGAAGAAGCTCCAGAGCTTAGAGAAGTAATAGAGGC
GTGCTCAGGGAGATTTCATATGTTAAATAATCGAGAAAAA
AGAGACAGAGCGCAAGTCGATGAACTTTTACGGAAGATTG
TGGTCATGATAAAACAGAATCAGAACAGCTATTATAACTA
CCACATGTTTGAGATGGCCAATGAACTCAACAATGTGAGG
AAAACTGCCAAGGAAAAGGATCAAATCATTGACGAATTGA
AGAAGGAGTTAAGGAAGATTCAAAAAGACACTGACAAGTC
ATTTTGCTGCATATTGTAGGACTGTCAACAAAATATTCCA
ATAGTGAACAGTGTTACAATCAAGTTTGGTCCAATCATTT
TTTTTTATTTTAAATATATAAAGTATTACTTTTTAATTAC
CTGGTTATAAAAGTATAGAAATTTAGTTTAATTATTTGCA
TCTAGTGTGTTATTGGTCTTGTTTTTGATCCTTTTTTTAT
ATATATTTTGTCTATTTAATTTAGATTTGTAATGATGTTT
TTGTTTTTGTTGTAATTGTAATTATTATTACTATTAACAT
TAATAATAATAATATTTTTAATAATATTATTATTATTATT
TTAATAATATTATTTAATATTTATTATTATTATTATGTGT
GGCTAAAAATTTAAGTTCAACGCCAAAGTTTAACATTTGA
CTTCTTTGTCCTTTGTCTACTGTCCTAGTTTTTCCTAAAA
CAGATTATTCATTTAAACTTTCTATAATAACAACAACAAA
CAACAACAACAACAACAAACGACTGAAATTTACTGGAACA
ATAAAATCACTGAACTTTAAAATGTGACATGATATGGAGT
TATATGATATGACTTAAAATGCACTGTGTAGTAAAAGCTA
GTTAAAGCTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations