Transcript

si:ch211-202h22.9-201

ID
ZDB-TSCRIPT-090929-21202
Name
si:ch211-202h22.9-201
Previous Names
  • si:ch211-202h22.9-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000041124 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000041124|OTTDARG00000029875|ZDB-GENE-030131-1143 si:ch211-202h22.9|OTTDARP00000032855 CH211-202H22.9-001 LG_ BX119918.18 Danio rerio protein_coding NOVEL, 689 bp
ATTTCTGCCAGTCGATCTCACAGGAGAAGCAGCACAAAGG
AGCACTCACACAGATCTTTAATAATGGAGAAGGACTACAG
ACCACCGCCTTACTCTTCTCCTCAGATGGATCAGACGCAG
ATTAACTACCCTGTACAGCCGGCACCGTATCCACCTCCTG
CAGGTCCTCAAGCAGCCCCTTATCAACCCCCTCCATATGG
ACCCCCATACACCAGCCAGCCCATGCCAATCCCTGTTCAA
CAGATGCCGCTGACGAGTCTCACGGACGTGCCGGGCCGCA
TTACCTGCCCTCACTGCCTTACTGAAGTGATCACAGAGAC
TGAACACGTCAGCGGTTTGATGGCCTGGTTAATCTGTGGA
ACCCTTGCGCTCTTTGTATGCTGGTTATGCTGTTGCATCC
CCTTCTGCCTGGACGCATGCAAAGATGTAAAGCACACCTG
TCCCAACTGCAGAAACATCATTCGCATCTACAAGCGAATT
CAGTGAAGAGGGATTGAACAAAATCTATTCATTTACCTGT
CAATGCACTGCAATATATGCACCATTTGTTCTACACTCCA
CCAAGGAGATTGAGTTGAGCTTTGTGAAGTCCTGTAAAAC
AGATTGATTTCATTAATTAATCAGAGACTCAGATGTGGAG
AACAACCGTTTATACTAATTTTATTTATAATAAACTCGTA
TGAAATAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations