Transcript

tmem72-202

ID
ZDB-TSCRIPT-090929-20996
Name
tmem72-202
Previous Names
  • tmem72-002
  • si:dkey-112k13.2-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000040903 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000040903|OTTDARG00000029745|ZDB-GENE-090313-175 tmem72|OTTDARP00000032686 DKEY-112K13.2-002 LG_ CR762483.10 Danio rerio protein_coding NOVEL, 699 bp
ACTGCGGCTCAAAATACCAGATTACTTACCATGCAGCTGT
GCTGGCACTGCCATCTTTGACTTTCTTTCTAAACTGTCAA
AAAATAAACTATTGATAGAGAACATTAGCTGTAATCAAAT
GTGCTAAAGGCAAAAGCATCTCATTTCGGCCATGAAGGGC
TCAGCTTTGTGGGTAATTGTGGAATGTTCCTGCAGAGTAC
TCGGCATCTCCACTGCAGCAGACTGTCCTCGCTGGTGATT
ATGATTTTTGAAGTCGCCTATTTTATTGACGCTCTGTTGG
CTACATGTCTTCCTTGTCCACCAACTTGGAAGATGTTCAT
TCTTTGGAAGAAGATGGCCAAAGTTGGAGGTTTTCAAAAA
TTCCTGTACTACACAATGATGTCTGTGATGTGTTTCCTGC
ATCCGGTGCTTGTATGGCATGCTGTGATTCCAGGGATTAT
GCTGGTTGTGACCGGATTCTTTAACTTCATACTGAGCAAA
AAAAAGAAGTCAGATGTGCCTAAAGAGTCCAGAGTTTTCT
ATGGTGACCCGGCTCTGTCTTCTGTCTGTGTCAAAGATAG
AGGAGACTCTGAAGACACGTTCTCTTTCTTTAACGTCATC
TCCGGCAAAAGAGCATCTTTTATTCCTAACAACAGCCGAA
TTCATGACTTAACAGACAGGGATCAGTCATTGAAGAATGG
TCAACACAAGAAAAGACAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations