Transcript

si:ch211-10a23.2-201

ID
ZDB-TSCRIPT-090929-20912
Name
si:ch211-10a23.2-201
Previous Names
  • si:ch211-10a23.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000040808 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000040808|OTTDARG00000029688|ZDB-GENE-090313-9 si:ch211-10a23.2|OTTDARP00000032617 CH211-10A23.2-001 LG_ BX323843.9 Danio rerio protein_coding NOVEL, 1951 bp
GGAAACCCGGTGGCGCGAGGCGGGGTTCGCGCATCCAACG
CCGGTCTCGCGCGCTCTGACGGTGCTGATCACTCCCGTTC
ATGACAGCTATTGTCCTCGCGCTCGATACGCAACACCTTC
ACGACTAAACTAAAGCCATTGCGACAAGCGGAGAGCATGT
CGGAAAAGGAAAACAACCGAAACGAGGAGGACTATGTTGG
GGAGATCAAAGGGGGTCTTCGGCCGACCATGAGGCTGATA
GTGATGGGTATTGTTCATAAGCAGCCTAAAAGTATGGTAG
TGATAGTGTCGTGCCAGTCTAAAGGAGAGGGGGATGAGGA
AATCGAGGGGGATGTTGGGCTGGAGTTAAAGGTGAACTTT
CCAGAAAAGGCCGTGCTTCGCAACGCTCGTCTGTCAGGAA
AATGGGGCTCTTCAGAAACCGCTCTGTCTTTCTTTCCCTT
TGCTCCAGGAGAAGCCTTTAAGATGGAGATTGTATGCGAG
CACCAGCAGTTTCGTATTCTGGTGGACGGGCAGCCGCTGT
GTGGTTTCGCTCACAGACAGACTCAGCTGGCATCTCTTAA
TGCTCTCAGAGTTCACGGAGATCTACAGCTCACCAAAGTG
GCTTGAGCAATAGGAGAAGTGCCTGCCAGGATGACAGACT
ATTCATAGGAGCAACCCCCGAGGATGAAGAAGCGTACTGT
ATTCAACTGATTTAAAGTTAAACGAGTTTCTCGGTTCATT
TATAACACCTAAATCTCATTTCAGTTTGTCCCGTGTTAGT
TTTAGTCGACTCAAGGCCTGTTCACACAAACAACAGGTCT
TTATTGCTCATTTTAGTTGATTTTGCTGCTGTTCATTTAA
AAAAAAAAGAATGTTTGTGTATATTTGGACACATTTAAAG
GAGAAAACCTCATGTGCAGCTAGTTTTAACCTACAAAAGA
GTAAAGAGTTGAAATACAGATTGCTTAAAATTCAAGTTAT
GATTTGGTGCAAGCTAGCTAGCATTGTAGATTATTTTTTA
GCTTAGCTTTTAAAACACATGACGTACTACCTAATGTTTT
TACTTTGCTTTGTGGTAACATTTGATCAGTTTATTTGGCT
CTTTGATACAGAAGCAGAAGTGCCTTCATTTGTTCCATTA
GATGCACTTATTAAGTAGACGACTTTAGGTGTGCTTGTAG
AGGTGATTGTAGTTCCAATTTATTTATGCATTTGATAGAC
GCATATTACATTGCATTCAAGCTATACATTTGATCAGTTT
AGGCATTTCCTGGAAACTTAACCCATGGCCTTGTCATTGC
TACGCTCTAAAGAATTGCTGGGTTGTCCATTATCATATCC
ATATTTTGGTTGAAATAAAACCAGCATTGATTGGAGTGTA
GCAAGGTGTTTTAGGGATAGTTCACTCAAAAATCAAGCAT
ATACTCCACTATTGCTTCCCCTTAAGTGGTTCCAAACTAA
AGTGGAACAGTGTTTTTGTCCTGTTGAACACAAAAGATAT
TTTGAAGACTGTAGGTAAGCGGTAGCCATTGACATCCATA
GTAGGAAATAAAAATACATTGGAAGTCAATGGCTAGCTTT
TTTCATTTCTGGGTGAACTATTCTGTGAACAGTTGTATTT
GTTTTGCTGTTTGAATGTTGAAACCATTTCAACAGAATAA
TTCAGAATCATCTTTTGTTGATGGGAATGTACCACAGAAC
TGGTCTGATGGCATACAGAAGCCTAGCATTCATAACTGAC
ACCCGAATGTTCACTTTAAAATGTAATTCCCTGCGAATGT
ATTGGTTTGAAGAAAAAGGACTCAAAGTCCATGTTGAGCC
TGTACTTGGTGCTGTCGGTCTACACAATGCTGCAAATGAA
GCATGTGTCAAATAAGGCTCATAGCAAGGTCTGCTTGAAT
GTCTTATAACATCTAACAATTGCAATATGTACTGTAAACT
TTTCTTAAACAAGAAGATCTGAATTATTTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations