Transcript

si:dkey-76k16.6-002

ID
ZDB-TSCRIPT-090929-20830
Name
si:dkey-76k16.6-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000040723 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000040723|OTTDARG00000029641|ZDB-GENE-090312-171 si:dkey-76k16.6|no_translation DKEY-76K16.6-002 LG_ BX005372.6 Danio rerio protein_coding NOVEL, 572 bp
AGTCGCTGCAGGTTTGAAAGCCTTTAATAAAAGTAGTTCA
TTTTGAAATAATAGTGCCGCTTGCAGAAACACGATTTACT
GTCCGTGTTGAAGAAACAGTCATTACAGTGCTCTGCAGAC
ATTAGTAAGCCTGCCGTTGTGTTGTGTCCAATGTATAATT
CATCTGTCCTGTATACATAAAGGCATATGGATCCATTGTG
CTGCGGAACAGAACAGGGCAGAGAGCTGATCCTGTTATCG
TGCTTGTTGACCAGTGGCCAGAGTTCAGAGTTTTACTCAT
TAAACCAGAATATCGTGAGGAGATTCTTTCAAAGACATGA
CTGTTTTCTCCAAAAACGATGATTACCTTAGAGACCTGCT
GGCACAGAGAGATGTCATTGACTGGAAGAAGTTCATTTGT
TTGGCTGCTGAGCTTAAGCATGAGAAAATTATGGAAGTTG
TGGCAGAAAACAGAGGTGTACCTGTGAAGAAAGAGGCAGT
GTGCCACATGTTGGTCCTACAAGATCTATCAAAACTTCCA
GCGTTTGATAGTTTATCACTGAAGATTTCCTCCCTCAATG
AGTCTCATCTTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations