Transcript

lhx9-201

ID
ZDB-TSCRIPT-090929-2066
Name
lhx9-201
Previous Names
  • lhx9-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000011772 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000011772|OTTDARG00000010247|ZDB-GENE-050417-210 lhx9|OTTDARP00000010165 DKEY-121A9.2-001 LG_ BX004971.7 Danio rerio protein_coding NOVEL, 1650 bp
CTTTCACGCATTCGGATCCTCAGTTGGAGATTGGGACTAT
CTGAAAACCCACGTTTAAAACATCCTCCAGACTTCAGTTT
TGCCTTATATCATCCGGACTATACTTTTTTCTGACGTTGG
AGAAAGTGGACTGGTTCTCCTGACTGTTCCTGCGCCGTCC
ATCAAATTCCACCGGCTTAATATTTTTGTAACACATTGAT
TGCATTTTGTTGTGAATCTGTTGGTGTAGATCCACTCGGA
TGTTTTAAGGATCCGGAAAGCTGTATATGGAAGTTGTGGG
GTGCAAGGCGAAAGAAAGCAGTTGCACATTGCGTCCAGCA
GCCATGCTTTTCCACGGCATCTCTGGGGATCATATTCAAG
GGATCATGGAGGAGATGGAGAGGAGATCTAAATCGGAGTC
TCGACTAGCAAAAACCGTCCAGATGAACGGACGGGAGACG
ACTATGCCCTCCATGAGCCCAGAGAAGCCTGCGCTGTGCG
CCGGCTGCGGTGGTAAAATCTCCGACAGATACTACTTACT
CGCCGTTGATAAACAGTGGCATTTAAGGTGTCTCAAGTGT
TGTGAATGTAAACTGGCCCTTGAATCCGAACTGACGTGTT
TCGCAAAGGATGGCAGCATTTACTGCAAAGAGGATTACTA
CAGAAGGTTCTCCGTGCAGAGATGTGCCCGCTGCCACCTC
GGCATATCCGCTTCGGAAATGGTGATGCGCGCCAGGGACT
CCGTGTACCATCTGAGCTGCTTCACCTGCACCACATGCAA
CAAAACACTGACCACGGGTGACCATTTCGGCATGAAAGAC
AACTTGGTTTACTGCCGGGTTCACTTTGAGACCCTTATTC
AGGGAGAGTATCACCCTCAATTAAACTACGCTGAATTAGC
GGCCAAAGGCGGAGGGCTTGCGCTGCCTTACTTCAATGGC
ACCGGCACGGTGCAGAAAGGAAGGCCACGAAAGAGGAAGA
GTCCGGCGATGGGGATTGACATCGGCTCTTACAGCTCAGG
TTGTAATGAGAACGATGCGGACCATTTGGATCGGGATCAG
CAACCCTACCCTCCTTCCCAGAAGACCAAGCGCATGCGTA
CATCATTCAAACACCATCAGCTTCGCACCATGAAGTCCTA
CTTTGCCATTAACCACAACCCCGATGCCAAGGACTTAAAA
CAACTCGCCCAAAAGACAGGACTGACCAAGAGAGTTCTTC
AGGTTTGGTTCCAAAATGCACGGGCCAAATTCAGAAGAAA
CGTTTTGCGGCAGGAGAATGGGGGTGTTGATAAGGCTGAC
GGCACGTCACTTCCGCCACCCTCTTCCGACAGCGGTGCTC
TGACCCCACCAAGCACGGCCACCACACTAACTGACCTGAC
CAATCCCTCTATCACCGTAGTAACTTCAGTCACCTCTAGT
TTGGACAGCCACGAATCTGGGAGCCCCCCACAAACTACCT
TGACAAACCTTTTCTAACACGGAGTTGCTTTTTTTGTCTT
TATCCCCCTTTATTTCCAGATTCTATTTTTATTTTCCACG
AAAAAACGAAAAACAGCAACAACACAAAAACCTTTTGGTG
ACCACCAGAAAGACTTTGGAAATGTAAGACGAGACCTACT
AAATGTGTAGCATTTGCAACCGCGTGGCAGCTGAGTTTGT
AGTACTTGTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations