Transcript

ankrd2-201

ID
ZDB-TSCRIPT-090929-20644
Name
ankrd2-201
Previous Names
  • ankrd2-001
  • ottdart00000040514
  • si:dkeyp-34h12.6-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000040514 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000040514|OTTDARG00000029515|ZDB-GENE-090313-383 ankrd2|OTTDARP00000032374 DKEYP-34H12.6-001 LG_ BX294129.10 Danio rerio protein_coding NOVEL, 888 bp
AATGGATGAAAACATCCTGTGGGCGACGGCTGTGGTGGAC
AGAAGAGCAGCTCTTGATAAACGTGAGGAGAAGCGTCGAG
CTCGGGCTCGGAAGTTGGGGATTTTGGTTGTGGATGCGGG
AGCCGAAGGAGGGAATGTATCTGTCAATCAAAGTCTTGCA
GATATTCAGGATGAAGAACGAGTGAGGAAGATCTCCTCTG
ATCTGAGGCGTGAGATTGTTGATCTAGGAGGCGCAGAGAA
CATTATTGAGCTGTGCACACAGAAGAAGAAGATCAAGAAC
AAGACAACACTTTCCAAAGACATAACGAATGTTTCTGGAG
CTGTGGAGCCAGAGGAGTTTTTAAAAGCAGCAGCTCAGGG
AAAGATGGAAGTAGTGGAAAGGTTTCTGGACGATGGGGGA
GATCCAAACACCTGTGATGAGTTCAGGAAAACAGCACTGC
ATCGAGCTGCTTTGCAAAATCATACTAAAATAGTGGAAAA
ATTACTGGACAAAGGAGCTGACATCAATTTTAAAGACAGG
CTGGGCTGCAGGGCTGTGCATTGGGCTTGCAGAGGTGGAA
GTCTCTCAGCATTAACAGTTCTTCAGGACAGAGGAGCAGA
CATCAACGTCAGAGACAAACTGCTCAGCTCACCTTTACAT
GTGGCCACAAGAACGGGTCACAGCGATGTGGTGCAACATC
TTTTAGACAGCGGAATCAATATTAATGCCAAGGATTGGGA
AGGAGACACGGTTCTACATGACGCTGTCAGATTTAATCGA
TATAAAATTGTCAAACAGCTCATCCTGGCAGGAGCCGATA
TGCAGATCAAGAATGCTGAGGGCATTACAGCCACTGAACA
AGTGAAGCAGTGGCAGTTTGACACTAAAGAGACACTGGAG
AAGCTGGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations