Transcript

vip-201

ID
ZDB-TSCRIPT-090929-20564
Name
vip-201
Previous Names
  • vip-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000040413 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000040413|OTTDARG00000029450|ZDB-GENE-080204-3 vip|OTTDARP00000032301 DKEYP-9B4.3-001 LG_ CR847786.14 Danio rerio protein_coding KNOWN, 1109 bp
AGACATATAAAACGAGGCGAGGGGTGAGACTATTCAAAGA
GACACAAGAGCGCCAAAAGGAACTTAAAAAGTCCACCTGG
AGACTTTGGGAGATTTGACTGGAGGTATTTCAGCACCCGA
TCAGAGCGCGGATCTCACATCTCCATTGCACATGTGTAAA
GCAATGCTTGTGCGGAACGGCGCTCAGCTCTTGCTCTTCA
TAACTCTTTCCAGTGTTTTATATGCCCGGACCTTAAGTTT
ACCCTTCGCCTCCATGAGAGAAACAAGACACGCAGACGGG
CTCTTCACAAGCGGATACAGTAAACTTCTAGGACAATTAT
CTGCCAGACGGTACCTGGAGTCATTGATCGGAAAGCGGGT
CAGTGATGATTTGATGGAAGACCAGGCGCCGATGAAGCGT
CATTCAGATGCAATATTCACAGACAACTACAGTCGCTTTC
GCAAGCAGATGGCGGTGAAGAAATATCTGAACTCTGTTCT
CACAGGAAAGCGAAGTCAAGAAGACCCACCCAGTATGCAG
GAGGAATCAGCCGGCGGAGAAACCACATATCGGGAGAGCT
ACGATGACGTGACTGTAGACCGACTACTCAATCATATACC
ATTGCCGCTCTGAGGTCAGTCCGAACGCAAGAAATCAAGA
CCATCCTTGGGTTTCCATTTTACACAGTCTAGCATAGGAC
ATCAGCATACTACTAAAACAACGTGTTGAAGAAAAAAATA
ATATAATGTGGTTACCTATGACGTAAATGTTTGCACTGTA
CATAGAAAATAAACTATAATGAGAGATGTTATAGCTTGAA
GATGTACATAGTGTGCTTTGGCCTTGGATCCGACACGTTT
GCTTTGACATGTTTCCTGTATATTGTAGATCAATAAATGC
ATTGAAACAAGCCACACCCGGACTGGTACAATAAGGAGAT
GAAGACTGCTGATTGGACGATGAAGTATCGCAGTGCGTTT
TTGTAAAATGAATTATTTTGTAAACAAAATAATATATTGA
TGTTGCTTCTATGTGAACTCTAGAGGGACCATTTGGGTTT
TGGGAGGGTCGGGCATTGGAAATCTTTATTTTTGCCATTC
AAAGAATAATAAAAGGTTGAAGAGCCATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations