Transcript

ttc7a-202

ID
ZDB-TSCRIPT-090929-20496
Name
ttc7a-202
Previous Names
  • ttc7a-001
  • si:ch211-93n23.6-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000040343 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000040343|OTTDARG00000029413|ZDB-GENE-010319-27 ttc7a|OTTDARP00000032243 ttc7a-001 LG_ BX004962.10 Danio rerio protein_coding KNOWN, 3075 bp
GAATGAGTGAGCGCTTCAGTTACTCATGATGGTTTTGTGG
CTAGTTAATAGATCACCACGATCACCTGCATGGCAAACCA
CTGCAAAGAGAATGAAAGGGCCAAATCAATTTTCCGACGG
CTGGAGTCGGCAGTCACTCCTCTGGTCTCGGTGGAGCGCG
GTCCCAGAGAAGCAGGCGGGATGTCTTCCCGACTCTCGTT
CTCTCAGTACCGCTTAGAAGCGGAGGTCGACCGCTGCCGT
TCGGAGTGTCAGTGGGATAAAATTCCCTCTTTGGTGGAGC
AGCTTGCTGCCGCGCGCCTGCATGACGATGATGATTACAG
GACGCTGCTGCTGGCCGAAGCGCTGCTGGAGGAATGTCTG
CTGGAGAACATGACCCTACTGAAGAATTCTACTCCTCTGA
CCGAACATTCACAGCTTAAACTGGCCCGAGCCAAAGCTCA
ACTCGACAGCATCCTTTGCAGGGGACACCTAGAGCCTCAC
TACCTGAATGAAGCTCTGCTCCTGCTGGCTAAAGTGCACT
ATGTGCAGGGACGCTACAGGGATGCTCAAGGGATGTGCGC
CAGAGCGGGAGTCGATGATTTCACCCACCAGGACCAGCCT
GTCTACCAACTACGAATGTTGGCAGAAGCTTTTGTCATCA
AAGGTTTGTCTTTGGATCATCAGTCTATGTCAGGTGCTTC
TCGTGTTAGGTTGTCTGAGAGAGAAGAAGAATGCCAAACC
TGTTATCTCATGGCCTGTGATGCTGGCCTGTTGTACCTGC
AAGAGCTTGACAAGACTGTTTGCACACCAAGTTCCAAAAC
AGCTAAAAGCGCTTCATCAGTCCCTCATTTTGATTTGGAC
CCAGGCTTCTTCCTGCAGGCAGCTCTTCAGAGTGCATACC
TGTCACTGTTGAGGAAAGGTCACTTGGCTCAGGGTACACA
CCAGCTGCGGCGAGTCTTGAGGGCTGTGGAGAGTCGGGGA
TCTCAGAGTTTTCGCAAGACGGTCGCACGCAGGCTTGCAG
AGGTGTTACTGGGTTCAGTGTGTGAGGACGCTTACTGGGG
TCCACTTTCTCCCCCACCACCTGGATGGCTGAAGAAAGAA
GGAGCCACACATCCGAAAGATGCCATCTACCCCTCGTCCA
AACCACCACAGCGCTACAGCACTGAGGGAGCTTTCTGTCC
AAAGGACGTGGTTGAAGAGGCGGTGCTGGTTCTCCTCATC
ACAGAATCAATGGCCAGTGGTGAGGCAGTGATCAGCCGCA
CACCGGAGCACCGGGAGGCGAGAGAGAGCAGCATGCAGGA
TGCCTCCTCTGTTTATGATCTGCTGAGCATCGGCATGGGC
AGGAGAGGGCAGTACTCCATGCTGTCAGAGTGTTTGGAGC
GGGCCATGAAGTTCTCCTATAATGAGTTTCATCTTTGGTA
TCAGCTTGGCTTGTCATTAATGGCAAGTGGGAAGAATGAG
GATGCAGTGGCAGTCCTTAAAGAGTGTGCGGCAATGAGAC
CACAGGACCCCATACCACCTCTGCTTGCAGCAAAAGTGTG
CATCAACCACCTGCACTGGCTGGAGGACGCGGTAACCCTG
TCAGCGGGTGTAGTTGCCTTAGGAGACTGTGCCGAGGAGT
CCCTTGCTCGAGCTCATCTGGCCATAGGTCTGTGCCGTAG
TCTGCAGGCCTCTGATGCCACACTGAAAGCAGATTGCGAT
GAGTTCAACAGAAGAGCTCTGCAGTCACTACGCAGAGCAC
ATGCACTGGACCCTCAAGATCCTCAGATTTCCTTCTACCT
TTCTCTGCAGTTTGCTCTGGTTCGACAGTTGTCAGAAGCG
ATGGAGCCATTGCAGTTGGCTCTGAATGTTCGTGGAGATG
ATCTGCACTCCCTACATCTTCTGGCTCTACTTCTGAGTGC
CCAGAAACACTACCAACATGCTCTTGATACGCTCAAACTT
GCCCTTAACCAGCACCCGGACAACTTCAATCTTCTCTTTA
CCAAAGTGAAGCTGGAGCAGGTTTTGTTTGGTCCGGGTGC
AGCTTTACAGACCTGTGCAGAAATGCTGCAGCTGTGGCAA
AGTCGCTATGATTTTACCCGACCCAGTGAAGAAGATGACT
CTAATAGCATACCTCCTGAACCAGGCCCACTGAGCAGAAA
ACCCAGCGGCCTCCATCTCACCCTTCCAGACTTCCAGGAG
ACAGAGACTGCTGTGTCTCGTCTGGAACAGGCCATGTCAG
AGGTATCGGCCATCAGCTCTGCCCATAAGCATGGACCTGC
CTACATTTGGACCACTCTTGAAAGGATTTGGCTCCAGGCA
GGGGAGTTGTTCATTGCTGATGGGCGGATGAAGGAAGCTC
AGTTCTGTGTGCAGGAAGCAGGAACACTCTTCCCCACCTC
ACATTCAGTGCTTTTGCTGAAAGGCTGGGTGGCCGAGCTC
AAGGGCAATGACACAGAGGCCAAGAGCCTGTACGATGAGG
CTCTTGCCATCAACCCAAGAGGACACCATATATTGCTGCA
CCTGGGGAAGTTGTTGGTTCGCACAGGACGTGTGGGTCTC
GGGGAGAAGATGCTGAGGGATGCGATACAGGTCCAGAATA
CTGCACACGAGGCCTGGAGTGGCTTAGGGGAGGCACTGCA
AAGCATAGGCAGTCCACAAGCTCCAGACTGCTTCCTCACT
GCGCTGGAGCTAGAGTCTAGCTGCCCTATACGGCCCTTCA
CTATCATCCCACGAGAACTATGACACTTATGTATATGAAC
AAATATGTACTGTATAGAAAAACCAATGACGCAGTCCAAA
AGCTAAAGGCAAGATCCATTTCATACACCAAAAAATGATG
CACGGTGAGTATTGTGGCAATGAATGAAACACAGAAAGTA
ACTTTAAAACCAAGCATCCTTTTGTTGGTTTTAACGTGAA
ACTGATTTGAGATCTTCATGATCATTGTTTCCCTCACATG
CAGGTGTGTAAATTCCTTTTAAAATTATAGCAAAGTTTGA
TCTGACCAACATCAAGAATGACAACTGTACAGATAGCCAT
ATTAGTGTCCACACTGCTTGAATGTTTTATTTTTATTATA
AATGCTTATGTTGATTATAAACATGCTGCTTTAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations