Transcript

gbf1-202

ID
ZDB-TSCRIPT-090929-20469
Name
gbf1-202
Previous Names
  • gbf1-001
  • ottdart00000040316
  • si:dkey-183c23.1-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000040316 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000040316|OTTDARG00000029397|ZDB-GENE-081107-54 gbf1|OTTDARP00000047841 DKEY-183C23.1-001 LG_none CR626878.14,CU463183.15,CU929381.13 Danio rerio protein_coding KNOWN, 9522 bp
AGGAAATATCAAGGTAGTGTGCGCCTGCACCATTTCCACG
TCAGTAAGTTTGCCTGTGGAGGAGATTACCTACCGGTGAC
AGAGTATCTGTCTAACGTTAATACTATAACAGAAAAACAG
CAGGGTATGACAACACTACGCGGAACAGTCTGAAATATTC
ACTATGGTGGACAAGAATATATACATCGTTCAAGGGGAGA
TTTCTGTTGTCGTTGCTGCAATCAAGAGGAACTCTAGATG
GAGTACCCATACACCTTTGGATGAAGAACAGGACACACTG
CTCAACAGCTTCAGGCTTTTGAAAGAGAGACTCAATAACA
TCAAAGATCTTTCCGATGTGGAACCCAATGTGTTTCTAAG
ACCTTTTCTGGAGGTGGTTCGCTCAGAAGACACAACTGGA
CCAATCACAGGCCTTGCTCTCACATCGGTCAACAAGTTCT
TGTCTTATGGACTTATAGGTAAATGCCAATCATGAAGGGG
CAGCGGAGTGCATCGAGAACATGGCTGATGCGGTCACGCA
TGCAAGATTCGTGGGCACCGACCCTGCAAGTGATGAGGTG
GTGCTGATGAAAATCCTCCAGGTTTTGAGGACTTTGCTAT
TGACTCCTGTTGGAGCCCATCTCACCAATGAGTCTGTCTG
TGAGATCATGCAGTCCTGTTTCCGTATATGCTTTGAAATG
AGATTAAGTGAACTGTTGAGAAAGTCAGCTGAGCACACGC
TGGTGGACATGGTGCAGCTGCTCTTCTCCAGATTGCCACA
GTTCAAAGAGGAGGCCAAGAGTTATGTGGGCACTAACATG
AAGAAGCTAAAGATGAGAGCCGGGGGAATGAGCGAGTCGT
CCAAGTGGAAGAAACAGAAGCGTTCTCCCCGTCCCCCTCG
TCACATGGTGCGCAGTCCCTCAGGACAGATGGATCCAGCT
CAGTCCAGCACTCTCACTAACAACCTTTCAGGTGGAGTTC
CCTTCATAGAGCAGCACAGTGGAGGTTCTTCTACATTTCC
TGGTTCCGACAGTGCAGCTTCCTCCATCTCCAGCCCCACC
ACTGACAGTGGCTTAGACACCGGCTCCAAAACCACCTCAA
AGGAGGATCTCACCGACCTGGACCAGAACAGCTCAACAGC
CACCACTCCCATCACACCCTCCGCAGAGCCGGGCAGACTG
GAATCACAGTCTGAGGGCAGAGGTGTGGAGCGAGCCCAGT
CCGCCTCAGTGGAGTCCATTCCTGAAGTCCTGGAAGACCG
AGACCTGCTGGCTGACCAGTCTGATTCAGCATCTGTCCAC
GATATGGACTATGTGAACCCTAGAGGAGTGCGCTTTACAC
AGTCTACTCAGAAAGAAGGTGCTGCTCTTATCCCGTATGG
TCTGCCATGTTTGAGAGAGCTCTTCCGGTTCCTCATCTCT
CTCACCAACCCACACGACCGCCATAACTCCGATGTGATGA
TGCACATGGGCCTTCAGCTCTTAAACGTTGCCCTTGAAGC
TGCACACATCGCCCCCTACCAGTCATTGCTCGGTCTGGTC
AAAGATGAACTCTGTAGGCACCTCATACAGTTGTTAGGTG
TAGACCGAATGAATCTGTACACCGCCTCTATACGTGTGTG
CTTTCTTCTGTTTGAAAGCATGCGAGAGCATCTAAAGTTC
CAACTTGAGATGTACCTGAAGAAGCTAATGGACATCATTA
CCTCAGAGAACCCGAAGATGCCATATGAAATGAAGGAGAT
GGCCCTGGAGGCCATAGTACAGCTCTGGAGAATCCCCAGC
TTTGTCACCGAGCTCTACATAAATTACGACTGTGACTTTT
ACTGCTCCAACCTGTTTGAGGATCTCACCAAATTGCTCTC
TAAGAATGCCTTTCCAGTGTCTGGGCAGCTTTACACAACC
CATCTCCTGTCACTTGAAGCCCTGCTGACAGTGATTGACA
GCACCGAGGCTCACTGTCAGGCCAAAGTGCTCAACAGCGC
TACACAGCAGGAACAGTCCGAATCCACAACCGTAGGAGAC
AGTTCAGTCAGTACCATCACAGATTCACCCGCAGAAACTG
GCAAACCTCATCCCAGTTCTAATGGACAGAACTCTGTGGT
GTCTGAGACGAGGGCTTCCTGTCCTCCCACCAGCGGTCAT
CTCATGGCAGAGAAGATGAGATTAGGTAGACAGGACCAGG
AGGAGACGGACACAGGAGAGAAGAAAATCTCGAAGAAGCC
TCATCGTTTCTCCAGCTATCTTCCAGACTCTCAGGAACTT
CTGGAAATCAAGAACAAGAAGAAGCTTCTGATCACGGGTA
CAGAACAGTTCAATCAGAAGCCAAAGAAAGGCATTCAGAC
CCTGCAGGAGAAAGGCCTGCTCAGCAGCCCCATGGATAAT
AACGAAGTAGCCCAATGGCTGAGAGAAAACCCCCGTCTGG
ATAAGAAGATGATTGGAGAGTTTATCAGCGATCGCAGGAA
TACTGACCTGCTGGACAGTTTTGTCAACACGTTCACCTTC
CAGGGTCTGCGCATAGACGAGGCCCTCCGCTTGTATCTGG
AGGCTTTCCGTCTTCCTGGCGAAGCGCCTGTCATTCATCG
ACTTTTGGAAACCTTCACTGACAACTGGCATAAAGTGAAC
GGTAATCCCTTCCAGACAAATGACGCTGGCTTCGCCCTGG
CTTACGCCGTGATCATGTTAAACACCGATCAGCACAACCA
TAACGTTCGAAAGCAGAACATCCCCATGACTTTGGAGCAA
TTCAAGAAGAATCTCAAAGGTGTGAACGGAGGAAATGACT
TTGATCAAGATATGCTGGAAGACATCTACAATGCCATCAA
GAACGAGGAGATTGTGATGCCGGACGAGCAGACGGGGCTG
GTGAAGGAGAACTACGTGTGGAGCGTTCTGCTGCACAGAG
GAGCCTCCGCTGAAGGGATGTTCCTGCATGTGCCGGACGG
CAGTTATGACCGTGACCTCTTCTCCATGACCTGGGGACCC
ACCATTGCCGCCCTCTCCTATGTTTTCGACAAGAGCCTGG
ATGATACTATTATCGAGAAGGCTATTGCTGGCTTTAGGAA
ATGTGCCATGATCTCTGCACACTACGGCTTCAGTGACGTC
TTTGATAACTTGATCATTTCACTTTGCAAGTTTACTACAC
TCAGCTCTGAGTCAGTAGAGAACCTACCCACCGTGTTTGG
CAGTAACAGGAAGGCTCAAGTCGCCGCTAAGACTGTCTTC
AGCCTGGCGCATCGTCATGGTGATATTTTACGAGACGGAT
GGAAAAACATCATGGACTCCATGTTGCAGCTTTTCAGGGC
TGAGCTTTTACCCAAGACCATGGTCGAGGTTGAGGACTTT
TTGGATCCTAATGAGAAGATTTCTTTACAACGTGAAGAGA
CGCCATCAAACAGGGGTGAGTCTGCTGTTTTGAGTTTTGT
CAGCTGGTTAACACTGAGCGAACAATCAGGGCTCAGAGGT
CCCTCCACTGAGAACCAGGAGGCCAAGCAAGCTGCACTGC
TCTGCATAAAGCAATGTGATCCAGAAAAGCTGAACACAGA
AAGCAAGTTTCTGCAGCTGGAGTCTTTGCAGGAGCTCATG
AAGGCTCTCATCTCTGTGACCCCTGATGAGGAAACATATG
ATGAAGAAGATGCTGCTTTTTGCTTGGAGATGCTGCTACG
TATCATTCTTGAAAACAGGGACAGAGTATCGTGTGTTTGG
CAAACGGTGCGGGATCATCTGTATCAGTTGTGTGTCCATG
CTAATGAGAGCTGCTTCCTGGTGGAGAGAGCAGTGGTGGG
ATTGCTCAGGCTTGCCATACGCTTGTTGCGCAGAGAGGAC
ATCGGCTCACAGGTTCTCCTCTCCCTTCGCCTGCTGCTGA
TGATGAAACCTCACGTCCTGTCTAGAGTCAGTCGGGAGGT
GGCCTACGGCTTGCATGAGCTGCTTAAAACTAACGCTGCC
AACATCCACAGCACTGACGATTGGTACACTCTCTTTTCCC
TCCTGGAGTGCATCGGCGCTGGGATCAAACCTCCGGCTGC
TCTGCAGTTCGCCAACACTAACCCAGACAATGACACAGGC
GCGCAGTCAGACAGTGAACTCAGCTCATATCATCAGAGTG
AAGTTAGTCTTGACCGGGGATACACGTCCGATTCTGAGAT
TTACAACGAGCATGGCAAATCCAGAATACCCCGTTCTGCT
ACTGATGTGGATGTAGGCTGGCTAGTGGTGGGTAAAGATG
ACCTGGACGGAGCTAAGGCAGCGGTGACCACACCTTCAAA
GCCCATGAACCATCCTCTCGTTAACCAGTACAGTTTAACT
CTCGGGCAGGACATGGGTCTGCATGATACCAAGTCCCTCA
TCAAGTGCGTGGATTCGCTTTCCTTCATCGTACGCGATGC
TGCTCACGTCACTCCAGAAAACTTTGAGCTTTGTGTTAAA
GCCATTCGTGTGTTCGTGGAGGCCAGCCTTAATGGAGGCT
ACCGCACCCACGAGAAGAAGAAGAGCCACAAATACGACTC
CAAATCCAGCCGGCTCCGAAAGAAGCCACGGGAGAAGGAA
GGTGCATCACGAAGAACCAAAGCGTCCAGTCAGCGGCCCG
CCCGTTCCCATAGCGACGATGAGGAGGAGGAGGGCGTGCC
GGCCAGTTACCACACGGTGTCTTTTCAGTTGTTAGACCTG
ATGCACACACTGCACACGCGAGCAGCCGGCATCTACAGCT
CCTGGGCGGAGGAACAGCGCCATCTAGAGGATGCAGGAAA
GAAGATCGAGGCAGACTCTCAAACGCTGTGGACCAGCTGC
TGGTGTCCGCTCCTTCAAGGTATGGCTTGGTTGTGCTGTG
ACGCACGTAGACAAGTCCGCATGCAAGCACTCACTTACCT
GCAAAGGGCACTTCTGGTCCATGATCTACAAACACTGGAT
GCGGTGGAGTGGGAGTCCTGCTTCAATAAGGTCCTGTTTC
CTCTGCTGACCAAACTTTTGGAAAATATCAGTCCAGCTGA
TGTGGGTGGCATGGAGGAGACCAGGATGAGGGCCTGCACA
CTGCTTTCCAAGGTGTTCCTGCAGCATCTCTCTCCTCTGC
TCTCTCTGCCCACGTTTGCTGCCCTCTGGCTCACCATTCT
GGACTTCATGGACAAGTACATGCACGCTGGATCCAGCGAC
CTTCTGCTGGAGGCCATCCCTGAATCCCTGAAAAACATGC
TGCTGGTAATGGACACAGCAGGGATCTTTCATAGCGCAGA
CTCCCGCACAGGATACTCAGACCTGTGGGAAATCACCTGG
GAGAGAATAGTCTGTTTCCTGCCCCGTCTAAAGGAGGAGC
TCTTCAAACAGGCTGTCATTCCAGAGCCTGTGTGTAATGT
TCCTGTGGAGCCCGTCCCGCCTCCTGTTGCTGTTCCTCCA
GCCGCTCCCACTGTTCCAGCTCCATCACCAGTGCCAGCAG
CCCCTGCAGAGCCAAATATCCCCAGCAGACCCTCATCGCC
TCAAGACATGCCGACACCGAGTGCCAACGGTGATCGAACA
GACAGATCATCTCCAGTTCCTCCCTCAACACCTCCGCTAC
CCACTCCAGCCAAGAAGAGTCCTCCAGAGTCCCCGCCACC
TCTCAGCCAGTCCCCGCTCATCCTCCAGCCCCTCGCCTCC
CCTTTGCAGGTGGGCGTCCCCCCTATGACCCTGCCAATCA
TTCTGAACCCCGCCCTCATAGAGGCCACCTCGCCCGTGCC
CCTGCTGCCCCGCCCCTCCGCAGACTGACCCGCCCCTCCG
CCAACTGCCCCGCCCACAGTGTTGCAGCATTTGAAGGAGA
AACGCGCTGGAAGAAGCATCTGATTTCACTGTAGCCCACA
CACTATTCAATTATGTAAGAGCAGGAGCTGGAAGAAGAGC
GTACGAGAGGACATTGAAATGCATGGTTGCCTCTCCTCGT
TTCAAACATCAAAGCTTCTCCCAGACCGATCAGACGAGAA
TGTCCTTCAGCCAGAGATGAGCATATTTATTCAAATCAGG
AAGGTGCCACCCCCAGAGGGACAGTTCATTATTGATGGGA
CGAGGTGTATTTCTGGTAGGTTAACTGCAGCTGTCAGAGC
AGATTTTAATGTGTTAGTACTGGTCAGGCAGAGATCACAG
AGAATGGCTGATGAGTAGAGGTCTGGCTTGTTACACCGTA
CAACATACTTTAGCGCTGAAGCTTTTAGCACCGCTCAAGA
TTAACAAGACTGTACAGTATGATGAAGAAAACCCTAACTT
ATTTAGACTATTCTTGTCGCTTTTACTCTTTAATTATAGC
ATATTGGCGTAAATTGGTCTAAAGGAAAATTGAAGTAATA
GTCCATCCAAAAACTGATAATTGTGTCATCATTTACTTAT
CCTCCACTTATTTATATGTATAAATGTGATAACACTTATA
ATAACTGCACAGTATGAATAATTTATTAAACGTTATCAAA
TAATGGATTCATTATCTGTTAAGCATTAACTCTACATTAA
TAGAGTAAGCAGTTTATAAGTGCAGTTACAAATTCTCTTG
ACATATAGGCACATGTGTAATGTGCTTAATGATTGTGTTT
TAATAGTTTGTTAATGATTCATTTTTCATTACTGAATTAA
ATATGCTGTTATTTACAAATCAGTTATTTCAGAATAGTTG
GTGGTTTTTAAAGATTATTCAGAATGAGAGAGATTAATAA
ACTATCCAAATCAACATTTATAATGCTTTTATTCAGTAAT
ATACTAATAGTTAATTTGTATGTTAATAAATGCTTTATTA
ACTCAACTTCATGTAGTTTTGTGACCTAATCTAAAGTGAG
GACTATTTATACTTTATAAATCCTTTATAAATGACAGTTA
AAGGCTCAGTTAAATTATATTAAAAAATACTTTATTCAAT
TTTATTAATTTGAAGATACACGAATGAAACTGAATCAAAT
GAGAAAATAAATCTTTGCAACAATATTCAAAATAAAATTA
CTGTACAATTTAGACATTGCTTAATAACATTAAAATGTTG
AATCATAATATATATTTAAATTATCCTATTGTTGTTTTAT
CCAAATTTTACAGTAATTTACAGTAGTTTTATTTTTTAAA
TACGATTGCAAAGATTATTGTTCTTTTAATACTCAGCATT
TAATTGTCATTTATAAGGGATTTACGAAGCATAAATAGTC
CTCACTTTAGATTAGCTCACAAAACTGCATGAACATGAGT
TAAAAAAGCATTTAATAACACACATACTAACCATTACTAT
ACGCCTGAATAATAAAATATATAAATGTTAATTAAATAGT
TTATTAATCATTTACTTACTCATTCTGAATAATCTTAAAA
ACCATCGACTACTCTTAAACACAACTAGTTTGTAAATAAT
GCAGTACTTTAATTTAGTAATGAAAAATAAATCAACAAAT
TGTAAAAATACAATTGTTAAGTACATTATAAATGTGTTTA
TAAATCAAGAATACAGCATTTGTAGCTGTAGCTATAAACT
GTTTACTAACATTTATTAATGTAGAGTTAATGCTTAACAG
ATAATAAATTCACTAGATGCTAATGCTAAATAAATGATTT
ATAGTATGTAGTTATTATAAAGTGTTACCATAAATGTTTA
TTTTTGTTATATATGTTTAAATAATGTTGGTATTCTGTAG
CTGCTAGTTTTACTGCTATGGTTGTAAGTTAATGGCCACT
GGTTACCAACATTTTTCTAAATATCTTCTTTTGTGTTCAA
CAAAGTTTGGAACCACTTGAGGGCGAGTAAATGATGGCTA
AATTGTCATTTTTAGATAAACTTTATCCAATATGCCATAC
AGGAAGAGTTCACCCAAGAATAGAAGTTCTCTCATCACTT
ACTGACCAACATCTCACTCCAAACCTTTATGGCATTCTTT
ATTCTGTAGAACACAAACAAATATTTATTTTCCAGTATGG
ACTATCACATTTCTCCAAATATCTTATTTTATTCCACAGA
AGGAGGGAAGTCATAAATATTTGGAACAAAATGATTGTGA
GGGAATGATGAACTACTCATTCTTTTTCAACATTGAGCAA
CTGAACATGGGTTGTACACGCACATAATTCATAGTCGTGC
ACCTCTACAACATTCCAGATAGCTGACTGATATGTTCGAC
TAAATGAACCAGCTGAACTCTGAATGTCAGGTTTTATTTT
ATTTTGATGGTTGTTTGTTTTATCGTTAACTTGTCTTAAA
GAGAGATGATTTTGCTGCTCAGGTTTGTGCTGTAGCACTT
TTGCTCTTTACAGCTTTCGTTCTTCAAGAGTTTTCTCCTA
GACGGATCAGTCCCCCCCCCCAGACACACTGTGTGTTTCT
GCTGGCCTTTCTGTTAAAGGGTTAGTTCACCCAAAATTGT
GATTAATTACTTGCTCTCAATTACTTTCAATCCCCAGAAA
CCTTTGTTCCTTTTCTGGAACACAAGTGAAGATGTTGTAG
ATGAAATCCTGGAGCTCTCTCATCCTTCATAGACAGCAGT
GAGACATTTAAAGTCTACAAAACACACTACATACCTTCCT
TCAGAGTCATATCAATTTACGAGAATACTGTTGTGTGTAA
ATAAAACTAAAATAATGACTTCAATCAACAGATTCATCTT
ATTGTCAGTATAGGGCACGTCATGTCAACGCGTTTGTGCT
TTGTTTCAAACAGAGGAAGTCGCATGTGGACATCCAGGGT
GAACCGTATACTGACAATACTACAGGACAGTTTCATCGTA
GTGTCAGTATAGGGCATGTCATGTAAACACATTTTTTGTG
CTTTGTTTCAAATAGAGGAAGTTGCATGTGGGCATCCAGG
GCGCACTCTATACTGACACTGAGAAAAAGAAACTGTTAAA
TAAAGTTTTTTTTTTACAGCATTCACACAAATTTGTTCTT
ATAGCTTGATAATATTCTGATTGAACCACAGAACATATAT
ATTTGTCTGAACTTCGATCAAGATAGGATCATTGCTGTCT
ATGGAGGAAGAGAGAGCTCCAGGATTTCATCTAAAATATC
TTCCTTTGTCTTCTGAACATGAAAAAAAGTCTCTGAGGAT
TTGGTGTGATGGGTGAGTTTGAACTATCCCTTTAAACTGT
TTCCCTTTACTGTGGTGATCTCAGCTCTGAAAGTTCAGTG
TCCACTTTTAGTCGTTTTTGAATTAATGTACACTTCAGGA
GACGTCGAAGCCAGACAAGAGCTATAAAATTGACTAATAT
AAAAGAAATATAATAGTTCTCAGACACGCACCTCCACTTC
CATCAGCCAAGACCACCCGAGAGCAGCTCAAATGCTTCTG
GGGATCAGTGTGTGTGTGTGTGTGTGTTTTTTCAGTTTGG
ATCAGTCCTGAGGCTGTAGGTGCTTTAAGGAGCGAGAGAG
TCGTTTAACGTCGATCAGTGATGACAGCAACACAAAGCAG
GTGGACATGTGGATGTTTTCTTTTCTTTGTTGTTCTGCAT
TCTTAGATGCATCAGGAACTAATTCTGTAGTCGACAGGTA
ATTCATTGAACATAATCTGTATATATATGAATAAAAGTTA
ATGTACTTTTTACAATGTAATAAATATATGGTCAGATATC
CT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations