Community Action Needed: Please respond to the NIH RFI
Transcript

slit1a-202

ID
ZDB-TSCRIPT-090929-20412
Name
slit1a-202
Previous Names
  • slit1a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000040240 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000040240|OTTDARG00000029347|ZDB-GENE-030722-3 slit1a|OTTDARP00000032166 slit1a-001 LG_none BX005147.15,CU462915.9 Danio rerio protein_coding KNOWN, 6008 bp
CGCTGGAGCAACTCTAGTAGAGAGAGAGAGAGAGAGAGGG
AGAGTTTTTTTGTGTGTGTGTGTGTGCGCGCATGTGTGTG
TGTGTGCGCGCATTGGATTTGGAAGCGCTGTAGTTTTCTC
GGGGAGTCTTAGGAAGATCATGCCTGCGAGAGGAGGATGT
TGTCTGCTGGAGGTGTGTGTGTGGGTTTTGCTGCTGGTGT
GTAAGACTGGCAGCGGGTGCCCGGCGCTCTGCACATGCAG
CGGCACCACTGTGGACTGCCACGGGCTCGGACTCAAAAAC
ATACCCAGGAACATTCCCAGAAACACCGAGAGGCTGGAAC
TGAATGGAAACAACCTCACACGCATCAACAGAAACGACTT
CACTGGCCTCAAGTATCTTCGAGTACTGCAGCTGATGGAG
AACCAGATTGTAACGGTGGAGCGCGGCGCGTTCGACGAGA
TGAGAGAGCTGGAGAGACTACGTCTGAACAGAAATCAGCT
TCACCAGCTTCCAGAGCTCCTGTTCCAGAAGAACGCCGCG
CTGTCCAGACTGGACCTGAGTGAGAACTTCATCCAGGCGA
TTCCTCGAAAGGCCTTCAGAGGAGCGACGGACATCAAAAA
CCTGCAGCTGGACAAGAACCACATCAGCTGCATCGAGGAT
GGAGCGTTCAGAGCCATGCGCGGGCTAGAAGTGCTAACTC
TGAACAACAACAACATCAGCAGCATCCCAGTGTCCAGCTT
CAACCACATGCCCAAGCTCCGGACATTCCGTCTGCACTCC
AACAATCTGGTCTGTGACTGTGTGCTGTCGTGGCTCTCTC
AGTGGCTACGCGAGCGGCCCAACATCGGTCTGTTCACCCA
GTGCAGCTCTCCAGCACCGCTGCGAGGACTCAATGTAGCA
GAGGTGCAGAAACACGAGTTCAGCTGCTCAGGTCAGTCTG
ACAGTGCTGTGGGTCAGTCGTGTAGTTTGAGCAGTGGCTC
GTGTCCCGCCGTCTGCTCCTGCAATAACAACATCGTGGAC
TGCAGAGGGAAAGGCCTGACCCTGATCCCCAGCAGCCTGC
CCGACAGCATGACGGAGATACGACTGGAACAGAACAGCAT
CAAATCCATTCCTCCGGGAGCCTTCTCTCCTTACAAGAAA
CTGCGCAGAATAGATCTTAGCAATAACCAGATTTCTGAGC
TTGCTCCGGATGCTTTCCAGGGTCTGCGTTCACTAAACTC
ACTGGTTCTGTATGGAAACAAGATCACGGATCTGCCCAGA
GGAGTGTTTGATGGCCTGCACGCGCTGCAGCTTCTTCTTT
TGAATGCAAATAAGATCCACTGTCTTCGAGCAAACACCTT
CCAGGACCTGCAGAATCTCTCTCTGCTTTCTTTATACGAC
AACAAGATCCAGACGCTGGCCAAAGGCACCTTTAGCTCGC
TGCGGGCCATACAGACACTTCATCTGGCTCAGAATCCCTT
CATCTGTGACTGTAACCTGAAGTGGTTGGCAGATTACCTG
CGCTCCAACCCCATCGAGACCAGCGGAGCGCGATGCACCA
GCCCTCGACGCCTCGCCAACAAACGCATCGGCCAGATCAA
GAGCAAGAAGTTCCGCTGCTCCGCTAAAGAGCAGTACGTC
ATTCCAGGAACTGAAGACTCCAGGCTGAATAACGACTGCA
ATAATGATCCCGTGTGTCCTGCTAAATGCCGCTGTGAGTC
TAATGTCGTGGACTGCTCCAATCTGAGACTCGACCGCATC
CCTGAACACATCCCAGCATCCACCACTGAGCTGCGTCTCA
ACAATAACGAGATCACCACAATAGAGGCCATGGGTGCTTT
CAAGACTCTTACTCACCTCAAGAAAATAAACCTGAGCAAC
AATAAGATCTCAGAGATCGAAGATGGAGCGTTTGAAGGAG
CGTCTTCAGTCAACGAACTGCATCTGACGGCAAACCAGCT
GGACTCGGTGCACAGCAGGATGTTCAGGGGGCTGGAAGGC
CTGCGCATGCTAATGCTGCGCAACAATCGCATCAGCTGCA
TCCACAACAACAGCTTCACAGGGTTGCACAATGTGCGTCT
GCTGTCCCTGTACGACAACACGCTGACCACCATCGCACCC
GGAGCCTTCGACACGCTGCAGAGCCTCTCCACACTGAACC
TGCTGGCTAACCCGTTCAACTGTAACTGTCGGCTGGCGTG
GCTGAGCAGCTGGTTGAGGAACCGTAAGATCGTGACGGGG
AACCCGCGGTGCCATCGGCCCGCATTCCTCAAAGAGATCC
CACTACAGGACGTCGCCGCTCCGGACTTCCGCTGTGAAGA
CGATCATGAGGACGTGAGCTGTGCGCCGCCGGTCCACTGT
CCTGCTGACTGCACCTGTCTGGAGTCTGTGGTTCGCTGCA
GCAACAAACACCTGCAAGCTTTACCCAAAGGCATCCCACG
CAACATCACCGAACTGTATCTGGATGGGAACCAGCTGAGC
ACGGTGCCAAAGGAGCTGTCGTCCTTCAAGAGTCTGCAGC
TGGTAGATTTGAGCAACAACAGGATCAGCTCTCTGACCAA
CTCCTCCTTCACCAACATGAGCCAGCTGACCACACTGATC
CTGAGTTATAATGCTCTGCGCTGCATCCCCACTCTGGCCT
TCAGTGGGCTGCGCTCGCTCCGCCTGCTATCTCTGCATGG
GAATGATATCTCTGAGCTGCCGGACGGGATCTTCTCTGAC
GCTCAGTCACTGTCACATCTGGCGATCGGGGCCAATCCTC
TGCACTGTGACTGCGGGCTCCGCTGGCTCTCAGACTGGGT
GAAGACCGGCTATAAGGAGCCCGGCATCGCCCGCTGCGCC
AGCCCACACGGCATGGAGGGAAAACTGCTGCTCACCACGC
CTGCAAAGAGGTTCGAGTGCCAAGGTGAGGTGGACTCTGC
TATCCTAGCGAAGTGTAACCCGTGTGCATCAGGGCCGTGT
CTGCATCAGGGTGTGTGTGAGGCGGATCAGACAGACGGCT
ACAGGTGCAGGTGTGCAGACGGATTCAAGGGTAAGAACTG
TGAGACGGTGGTGAACGCGTGTGTCAGTGAGCCGTGTAAG
AACGGAGGAACGTGTCACGTGTCCACAGACGAGGATGAAG
GATACAGCTGTTCGTGTGCTGCTGGTTTTGAAGGTCCCTC
ATGTGAGGTGGACACTGACGAGTGTAGAGATAATGACTGT
CAGAACGGAGCCACCTGCATTGACGGCATCAACAATTACA
CATGTCTGTGCGCCCCGTTCTACACAGGGGAAATGTGTGA
GGATTTGGAGGACATGTGTTCATCTGCACGCAGCCCATGT
AAACAGCAGTCCACCTGCTTCATCACAGTCACTGGACCAA
AGTGTATCTGCGCTGCTGGTTATGTGGGTGAGGACTGCAG
TGTGAATTATGATGACTGTAAGGATCACCGCTGTCAGAAC
GGAGCTCAGTGTGTGGACGAGCTTAACGGATACTCCTGCG
TCTGCCAGAAGGGATACAGTGGTCAGCTTTGTGAAGTGGC
GCCTCCTCCTCGTTCTCCGTGTGAGCGGGCCGACTGCCAG
AACAACGCCCCATGTGTGGAGCGCGCTGGGCACCCGCTGT
GCCAGTGTCTGGAGGGCTTCGGTGGGCCGCGCTGTGAAAA
GCTGGTCAGCGTCAACTTTGTGGACCGAGACTCGTATCTG
CTGCTGAGCGACCTGAAGAACTGGCCGCAGGCTAACATCA
CGCTACAGGTGTCCACAGCTGAAGATAATGGCATTCTTCT
GTACAATGGAGACAACGATCATATTGCAGTGGAGATTCAT
GAAGGTCATGTTAAAGTCAGCTACGACCCCGGCAGCCAAC
AAAGCCACGCCATCTACAGCACTGAGACGGTCAATGATGG
TCAGTTCCACACCGTAGAGCTGGTGACCTTTGACCAGATG
GTGAATCTGTCTATAGACGGCGGCAGCCCCACGACCATGG
ACAGCTTCGGGAAGGTGCAGCCGCTGAGGGGAGAAGCTCC
GCTGTATGTAGGAGGCATGCCGGTGAGCGTTCACCCCACA
GCGCCGCGGGTCTGGCAGATCCAGAACAGCTCCAGCTTCC
ACGGCTGCATCCAGAATCTGTACATCAACAATGAGCTGCA
GGATTTCACCAAGACGCAGATGAAGCCCGGCGTGGTGCCC
GGATGTGAGCCCTGCAGGAAGATATACTGCCTGCATGGCA
TCTGCCAGCCCAACACCGCCACCGGGCCTGTGTGCCACTG
CCAGCCGGGCTGGAGCGGGCAGCACTGCGACCAGCCGCTG
GCGAACCCCTGCATGGGCAGCAAGTGTGTTCACGGCAGGT
GTATACCGATGGACATGCAGTCGTACCGCTGTGAGTGCCA
GGAGGGTTTTCATGGTGCGCTGTGCAACCAACATGAAGAG
CTGTTCAACCCGTGCCGAAAACTGCAGTGCAAACACGGCC
ACTGCCAGATCTCTGACACAGGAGACGCGTACTGCCACTG
CGAGCCGGGCTACAGCGGAGACCTGTGTGACCGCGAGTCG
GAGTGCCGCGGGGAGCCGGTGCGGGACTTCTACCAGGTGC
AGCGTGGTTACTCCATCTGCCAGACCACACGCATGGTGTC
GTGGGTGGAGTGCAGCGGTGTGTGTGAGTCTGGCTCCTGC
TGCGCCAGCCAGCGGATGAAGCGCCGGAAATACAGCTTCG
AGTGCAGCGACGGCACGTCCTTCAGCGAGGAGGTGGAGAA
AACCATCAAGTGTGGCTGCGTGGGGTGCATGTAGGACACG
ACCAGCAGCACACCGTCATCACAGCCGCAAAACACACCAT
CCCCCATTGGGTATTCAGAGACGACAACCCGTAACAACAC
CCGGATAAATTCAGCCTCTTTTTGTGCTTGCGCTCGTTTC
AGCAGGACAGAAAAGTCACGTCTTTCTGTTGTTTTTTTGA
CTCTCTCTGGACGTGTATCTGAGCAGATAATGGCGACGCA
AGCACAGAGCTTCCACATTTGCGAGCACAAAACAAGCTAA
ATGTAATATATATATAGATATATATCTGTGAAAGGGAGCG
TGCGATGGATTGACATGCTGTCGAGACAGATATTTTCAGT
CATTTTGTGATTATGTGGGGCACACAGGACTCTTCTGCGT
GTCCTAAATCCACAGTGCACGTGATTGATAGAAGATGCAT
CGGATAAAATACACAGTTATCATAGGAGCTGCTTTACAGT
ATCTCAGCCTTTGGTAGAAAACAAAGTCAAACTAAATCTA
ATAGATGACTTGGCAGACAAAAATACCATTCAATGCTCCT
TAAACAGCTACCAAAGGAGCTTCTTTACAATATCTGGACT
TTTGGTAGAAAACGAAAGTCAAACTAAATCCAGTAGATGA
CATGGCGGACAAAAATACCCATTCGACACTCCTCATATAG
TTACCAAAGGAGCTTCTTTACAATATCTCGACTTTTAGTA
TAAAAACGAAAGTCAAACTGAATGGAATAGACAACAAGGA
GGACAAAAATACTATTTCAACGCTCCTTGTATCGTTACCA
AAGGAGCTTCGTTACAGTGTCTTGACTTTTAATAGAAAAC
GAAAGTCAAACTTAATCGAATAGTTGACACGGATGATTAA
AAAACCCATTCGATGCTCCTTATGCCGTTAACAAAGGAGC
TTCTTTACAATATCTGGACTTTTGTTAGAAAACGAAAGTC
AAACTAAATCCAGTAGATGACATGGCGGACAAAAATACCC
ATGCGACGCTCTATAGTTACCATACGAGCGTCTTTACAAT
ATCTCGACTTTAATAGAAAACAAAAGTCTAACTAAATCAA
ATAGTTGACACTGAGGATAAAAATACCCATGCGACGCTCC
ATATATAGTTACCAAAGGAGCTTCTTTACAATATCTGGAC
TTTCGGTAGAAAACAAAGTCGAACTAAATTTAATAGATGG
TTTGGCGGACAAAAATACCCGTTCGACGCTCCTTATATAG
TTACCAAAGGAGCTTCTTTACAGTATCTCGACTTATAATT
AAAAAAGAAAGTCAAACTAAATCAAATCATCAACACGGAG
GATAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations