Transcript

bag1-201

ID
ZDB-TSCRIPT-090929-2041
Name
bag1-201
Previous Names
  • bag1-001
  • si:dkey-216e9.4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000011681 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000011681|OTTDARG00000010168|ZDB-GENE-050309-89 bag1|OTTDARP00000010076 DKEY-216E9.4-001 LG_ AL929096.5 Danio rerio protein_coding NOVEL, 1298 bp
CGGTTGCACATGTACACACTGCAAAGTTGTGAAGCGCTAG
CTAACAGTGTGCCGATATGGCGGAGAATGCCTTGACAGTG
ACAGTTGCTTATGGCACAACCAAACACAGCATCACTTTAA
CAGGTCAAGATGGACATGAACCACTGTTGAAGGATTTGTG
TGAGGCGCTGACAGAAGCCACCGGAGTACCAGCACCATCC
CAGAAAATCATATTTAAAGGGAAGTCATTAAAGGAAATGG
AAGAGCCGCTGTCTGGCTTTGGAATAAAGCAGGGTTGTAA
AATGATGATGATTGGAAAAAGGAACAGCCCCGAGGAGGAA
GTTGAACTAAAAAAACTTAAAGATATTGAAAAGTCAGTGG
AACAAACCGCTAAGAAGCTTGAGAAGGTGGACGGTGAACT
CACTGGACTGAAGAACGGTTTTCTTGCGAAGGAGTTGCAG
GCTGAGGCGCTAAACAAACTGGACCAAAGAGTGAAAGTTG
CTGCCGAACAGTTCATGAAGATCCTTGAGGAAATAGATGG
AATGAGCTTGCCTGAGAGTTTTAGCGATTGCAGGATGAAG
AAAAAAGGACTTGTAAAAACTGTTCAGGGGTACTTAGCGC
AGTGTGACAAAGTTGAAGCTGGAATATCAGATCACCTGGC
CAAGATTCAGACTAAAAACTTAGCCTTAGCAGAGTGATGG
TGAATAAAGACCGGAGGCATCAGCAGTAAATGTTGCTGCT
CTGTGGGCGACTGAAAATCCTCACTGAGAGCTTTGGCACT
GGAGGTGGTCCTGCAGTTCATCTAAACCCCATGACCCACA
CATGCACCTCTCATACAGAGAACAACGGCGGCATTTCAGA
CATTTTCTTATCAGTTTAGATTTTTCATGGTAAATGTTAG
AAATACCCATGGCTTATGACAGGTTTAATGACGGAAAAGT
TTCAAAAATCTGAAGCCTTTTAACTTTGTTACCTAGCCTA
AGTTTGACAGATATTTGGATTCATAGTCGTATTACTTTGG
TCAAATGGAAAAAAAAAGATTAATAATGGTGCTGGAAGAA
TGTCCTTTCATGTGATTTCATTAAATGATGTAATTCAATA
CATAACTCAACCTGGTGTGAAACTTTTAGATTAAAAAAGT
TATTCTATTTATTGAAAGGGTGGAATTGTTCAAAGCAAAG
GAGTGTAGCTTGATAGTCCTTGTTTTGTTTTATCATTATT
AAATCTCAGGGTGCTTCAAACCACTGGTGGTTTTCTCCAT
CGATTTATGTCTCCAATGTTGTTCTGAAGTTAATGAGAGA
AATTAAACATTTGAAGAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations