Transcript

chmp5a-201

ID
ZDB-TSCRIPT-090929-2040
Name
chmp5a-201
Previous Names
  • chmp5a-001
  • si:dkey-216e9.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000011680 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000011680|OTTDARG00000010167|ZDB-GENE-060503-60 chmp5a|OTTDARP00000010075 DKEY-216E9.3-001 LG_ AL929096.5 Danio rerio protein_coding NOVEL, 1038 bp
ATTATGGTGTGTATTCCACGACCAACCGGAAGAAGCGCGT
TGTGGTGGTCGGCATTTAAATACCTCTACAAAGCAAATAA
GTGTCATTCCCATATAAATATGAACCGAATTTTCGGTCGG
AGCAAACAAGCGGCGTCTCCCAACCTTTCTGACTGCATAG
GCAATGTGGACACGAGGATTGAGTCAATCGACAAGAAAAT
AGCGAGAATCGATGCCGAGCTCATGAAGTATAAGGACCAG
ATGAAGAAGATGAGGGATGGACCCTCAAAAAATACAGTGA
AGCAGAAGGCAATGAGAGTGCTGAAACAGAAGAGAATGTA
TGAGGGCCAAAGAGATCAACTTTCTCAACAGTCTTTTAAT
ATGGAACAAGCCAACTATACAATCCAGTCTTTAAGGGACA
CCAAAACAACAGTGGAAGCTATGAAGATTGGAGCAAAAGA
AATGAAGAAAGCATACAAACAAGTGAAGATGGATCAGATT
GAAGACCTGCAGGATCAACTGGAGGACATGATGGAAGAGG
CCAACGAAGTACAGGAAGCTCTCAGTCGCAGCTACGGCAC
ACCAGAGATCGACGAGGATGAACTGGAAGCAGAACTGGAT
GCTCTGGGAGATGAGTTGCTGCTGGATGATGATAGCTCTT
ATTTAGACGAAGCCTCATCTGCTCCCTCTATTCCTGAAGG
AATGCCCAGTGACACCAAAACTAATAAGGATGGCGTTCTG
GTGGATGAGTTTGGCCTGCCACAGATCCCTGCTACATAAG
AATCTGTTCTCAGAGGAGTTTTTTTTTTTTTTTTTTTTGG
TATGGTGGAAGAAGTGTTTTTGTGTTGGTGTTTAAGTTTT
CTTGCATTCATTACCCAGTCTAGCACATGGCTTTGTAACT
ATAATGTGTTGAACATAATATTCTAAGTTTATTTAGAATT
CAACATTCAATTTTGCAGTCACTTTTAGTTTTTAGTTATC
CAAAAAAGGCTCATTGCATGTGGGTCAAAGACAAAAGGCA
AGGCAAGGCAAGGCTAGTGTATTTATATAGCACATTTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations