Transcript

klf12b-201

ID
ZDB-TSCRIPT-090929-20399
Name
klf12b-201
Previous Names
  • klf12b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000040223 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000040223|OTTDARG00000029333|ZDB-GENE-071004-22 klf12b|OTTDARP00000032151 klf12b-001 LG_none BX571809.10,CU463282.7 Danio rerio protein_coding KNOWN, 1826 bp
ATTCATTTCCTGAGAACTGCCCTGAGCAGCTGAGAGGAGC
AGAGAGGGGAGGGAGTCACAGAGAGAGAGAGAGAGAGAGA
CAGACAGAGAGGACTGTATAAGGAAGACAGTTTCTGTCGC
TCTGCAGCTCCTGGTCAGACGCCATCAATAACAGGATGTT
AATGCTAGACGGAATGCCTGCAGTCCGAGTCAAAGCAGAA
CCTCTGGAATCTGAGAGAGGGTCACCCAAAGTGCACGGCT
ATCCAGATATGGAGGCAGTGCCGCTTCTGCTCAGCAAAGT
AAAGGCAGAACCTCCAGAAGACCTGCTCTCATCTGATCAA
TTCCAGACCCAGACGGAGCCTGTGGACCTGTCCATCAACA
AGACACGGACGTCATCTCCTTTATCCAACAACTCACCCGT
TACCTCAGCCTTTTCTCCATCCTCTTCTTCATCATCTTCA
TCCTCACCTTCCGTCATTGCCTCCGTATCATCTGGAATGC
CCTCTGTGTTGACATCCGGGTCCTTAGTGGGCTCTTCTCA
TGGAGTTAGGGGCCAGCAGTTTTTGCATATCATCCACCCC
GTCCCCCCTTCAAGCCCCAGTAAATTGCCCAGCCAGGTGC
ACCGTATCCCTGTGGTGGTGCAGTCGCTGCCCCTCATGTA
CACCACATCCGTACGTTCCCCGTCCACCCTCAGCTCCACC
ATCATGTTACCTCTCCTGGATGAGGCCAGGTGCCAGGATA
AAGCACAAACAGACCCCAATGGCCTGTCGCCAAGACAAAT
CAAAAGTGACAGTGATGATGACGACCTGCCAAACGTGACC
TTGGACAGTGTTAATGAAACAGGATCCACGGCGCTGTCTA
TAGCACGAGCAGTGCAGGATTCCATGTCACCATTCAGTAT
TGAGAGCATTCGACGGCCACCGCCACCTGAATCTCCAGAC
TCAAAGAAAAGACGCATCCATCGCTGCGACTTTGCAGGCT
GTAATAAAGTTTATACCAAGAGCTCCCATTTAAAGGCACA
CCGGAGGACACACACAGGTGAGAAGCCATACAAGTGCACC
TGGGACGGCTGCACATGGAAGTTCGCCCGCTCGGACGAGT
TAACACGGCATTACCGCAAACACACTGGGGTCAAACCCTT
TAAGTGCGGAGACTGCGACCGAAGCTTCTCTCGCTCAGAC
CATCTGGCCCTGCATCGTCGCAGACACATGCTGGTTTGAA
AACACACACATGCATACACACACACACACACAGGAGAGCT
GGATCTCCCTCAATACTGTTCAGCTGGGCTGGACACACAA
ATGGCAATCCCTGCTCCTCAGAAACATCCAGAGAGGATAA
AAGAGCAAGCAGAAGACGGAGGATTACAATGCTTTCCCCA
CAATTGCAAAGCTAAACAGGGTCCATTCAGGAAGGGATGA
GGTTCAGCTACGCATTTTGGAGTCTACGATGTGGATCGTT
TCATTTTTGTTCAGAGGAATATTTCAATCGGGCAAATGCT
TTCTTTCCTGTTTTGTCTTTTTCTTTCCGAATCATACTTT
CATTCTGTTTAAACATGGCTGCTTCTTACTCAACATCTAC
AATATGAAGAAATGCAGCGTGGAATGGCTTCGTTAAACAT
TTGCTTGAACATCTTTTTTTTGTGGAACATCAAGAGCCGG
ACACGTCTGAGGAAGATGGTAGTTGTTTTTCTGATGACGG
AGACTTTTGATTCCAGAGATTGCCGTTTACAGGTCAACAC
ACCAGCGAATGAGATTACACAACAACCAACCTATTGAAAT
GATCTTTCGTTTCCTCCTGCTGTTGATTTTGAACTGATTG
ATTTTGATAAACCGACAAAAAAATAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations