Transcript

il11b-201

ID
ZDB-TSCRIPT-090929-20388
Name
il11b-201
Previous Names
  • il11b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000040212 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000040212|OTTDARG00000029326|ZDB-GENE-051019-2 il11b|OTTDARP00000032143 il11b-001 LG_ CU464201.12 Danio rerio protein_coding KNOWN, 578 bp
TGTCGCCTGACTCCACCTTTCCCCTCATCATCCTGATGGC
TTGCGTTGAGCTTTTTGACTTCATCAGAGCACGTCCTGCT
AATCTACCACAAGGAAAGAAACACCTGTCGACGCTGTACC
AAGACATGCGTATGCTCCTGAAATTAACATCCCAACAAAT
GAACGCAAATGAGTTGACTGACTTTGAACATTCGCTATCA
TCCCTGCCCTCACTGAACTACAGCGTAAAAGACCTGCATT
CACTTGAGGTGAGCAGTACCTTGGCACAGCTGTACTCTGG
TCTTAAATCTTTCAAGTTCCATCTTGATTGGGTCCAACGG
AATAGTGACGAATTGGGGAACGATTACTCAAAAACAAAGA
AGATTGTTCATCTTATCCAAGCTATCATCCAGAAGGTGCT
CCAAGAGCTCGGACAGACAGCACCCGAGATCGTCCATCCC
ACATTGCCTCCTCTGGAAACCTTCTGGCAGCTGTACCAGA
CCAATGCAGAGATTCATAAAAAACTGTTGATCTTCTGTGA
CTATTACACCAGAGCACTTGGATCCCTGAAGCGCAAACAC
CCTGATACACCATCATAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations