Transcript

si:ch73-382f3.1-201

ID
ZDB-TSCRIPT-090929-20026
Name
si:ch73-382f3.1-201
Previous Names
  • si:ch73-382f3.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039776 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039776|OTTDARG00000029029|ZDB-GENE-030131-9513 si:ch73-382f3.1|OTTDARP00000031801 CH73-382F3.1-001 LG_ CU571172.7 Danio rerio protein_coding PUTATIVE, 1732 bp
ACGTCTCTTGCCGAAGTTATCGGCGCCATTTTGGCTCAAA
CAAACTCTGCATTTCACTTACTAGTAAAACATATTCGTCT
TCCAGATTCGCATTTTTAACTAAATCAATTAAAGAGACCG
CCCGTAAACTCGTTGTTTACGTCTGCTAAAACTACTGCTG
TCTGTTGTTCTAAAGTCTAAAGGGTTTTTAATAATACACC
TGCTAAGTCCTCTGCTAGCAGACCGCTACTTATAATCGTT
GTTTCGCACAGATGTGAAGTTAAATACTTGGCGAATGTAA
ATAAAAATGGGTGGATGCTCCGCTCCTAACTGCTCGAACT
CTACAACTATTGGAAAGCAGCTTTTTCGCTTTCCGAAAGA
CCCGGTGCGCATGAGAAAGTGGCTCGTAAACTGTCGGCGT
GATTTTGTACCGACTCCCTGCTCCAGACTCTGCCAGGACC
ACTTTGAGGAAAGCCAGTTTGAGGAGATCGCCAGATCACC
AGCAGGGGGAAGGAAACTCAAACCCAACGCAATCCCGACG
CTGTTCAATGTGCCAGACCCTCCCTCTCCTGTCACCCCTC
AAGCAGTGTTACCTGTCAAAAATGAGCCAGTGGAAAAGGA
GCTGAACATGGGGGATCATGGTTATGCCCGCCGGCAGCCT
CCTGTGGATTCAGAGGAAGATGGTGTTCAGAGGGCTGAAG
AGGAGCAACCCTGCTCTCTTTGCCAGCATTATAAAACCAA
GCTGGAGCAGCAACAGCAGCACACGGTCAGACTACAGAGA
GAGGCGGAGGAGATGAAGAAGCGTCTTTACAAACTGAGTA
AAATAGAAAAGGGGTTGCAGGTATTCCTGTTTGAGGACCA
GATACGGGCCCTGACATTAGCCAAGCGCTCTCGGAGGGCT
GTGTGGTCACATGACACCTTACTGACCGCCCGAAAGATCC
GCTGCGCCGTGGGGGTTAAAGGATACGAGTACCTCAGGGA
ACTTGGCTACCCTCTACCTTCTTACAGGACGCTGTGCAAT
CGACTGGAGCCCAAAATGATGGTAAGCACGAGCATGCAGG
ATGAACTGGCAGAGCTGGGCCTAGGCATAATAGCAGCCTG
TGACAGTCCAGAGGGCAACATGACAAGCGATGAAGGACTG
ATTGGAGTCATGACCTGAAACACCGCATTTGTGAGACGGA
ATTGAAACGTGACTGTTAATCCAGCCAGGCGAAGCTAAAG
CAGGACACACAGAGGATGTTTGGTATACGTTATTTTGGGT
GGTTGTTGTTGCATAAAAGCATTGGCATAAATACCACAGC
AGCCTGAAGTTGGTTCACTTCATTTTCAGACTTCTTTTCT
CTCAGATTGAATAAAATATTAGGGTTTTGCTACATCTTGC
TGTGTAGTTGCAAGTCCCCAATGCTGATATTGCACCTGGG
TTGAGGAAATGGAGGTAAATTGGTGGACTATTCCAGCTGT
TTACAGACTCAGTTAATGCTAAGAATCTGGCCCGAAAACC
AAATGTCTTAAATTTGATTTTTGCTACTGAGACAAAGGTT
TTAGATTTCATGCTAGTTTCTGTAAGAGGACGTTGGCAAT
TGTGAGGTAAATGTTCAAATTGGAAAGACAGGTTCCTATT
TTAATGGTATAGGTCTGGTATGTGATGTGTAGCGAAGAAC
GTTAGCAGCCCAAAAAAATTGTGCAAAAAAGCCATCGCAA
AACTGAATGATGCTACTGTTCTGGAAAAATAAATTTCTTT
CTGCAAAGCAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations