Transcript

gnat2-201

ID
ZDB-TSCRIPT-090929-19693
Name
gnat2-201
Previous Names
  • gnat2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039396 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039396|OTTDARG00000028798|ZDB-GENE-011128-10 gnat2|OTTDARP00000031512 gnat2-001 LG_ CU462975.9 Danio rerio protein_coding KNOWN, 2170 bp
GAGGAATTAGAGGGGATAGAGCAACCAAAGGAAGAAACAG
TACAGTCCACTTCAGTCTCTGTACCTGTCTCTATCCACTT
GTCCACCTCCACGTAGGTCACACTTAGAAGGGGAATCAAG
ACTTCTGCGACCCTCCCCCTATCACGTGATCTGAGGTACA
GGGCTACCTGCATCCATTTCTCTGTCTGCAAAGCACAGGG
GAAGCCGGCAAAATTTCTTTCCTTGAGGAACTTGACAGGG
AAGCGTCAGACGACGAGATGGGTAGCGGAGCGAGCGCAGA
GGATAAGGAAATGGCCAAGAAGTCCAAAGAGCTGGAAAAG
CAGCTCCAGGAAGATGCCGATAAGGAAGCCAAGACGGTCA
AACTTCTGCTGCTGGGTGCTGGTGAATCAGGGAAGAGCAC
CATTGTAAAACAGATGAAGATTCTCCATCAAGGTGGTTAT
ACAAAAGAAGAACAAATGGAGTTTCGATCTATTATTTTTG
GCAACATCCTGCAGTCTGCTCTGGCCATCATCAGGGGCAT
GGAGATGCTGTCAATCAACTTTGGATCGCCATCTGCACAG
GAGGATAGTCAAAAGCTCCAGAACCTGTCTGACTCCATTG
AGGAGGGCACCATGCCTCCAGAGCTGGCAGACGTCATCAA
AAGGCTATGGAAGGATGCAGGCGTGCAGGCCTCTTTTGAT
AGAGCTGCCGAGTACCAGCTGAACGACTCTGCTGGATACT
ACTTGAACGAAATGGACAGAATCTGCAAACCTGACTACCT
TCCCACCGAGCAGGATGTGCTGAGATCTCGAGTCAAGACC
ACTGGTATCATTGAGGAACAGTTCGGTTGCAAAGAGCTCC
ACTTTAGGATGTTTGATGTGGGTGGCCAGAGGTCCGAGAG
GAAGAAATGGATTCATTGTTTCGAAGGTGTGACTTGCATC
ATCTTCTGTGGAGCTCTTAGCGCTTATGACATGGTGCTGG
TAGAAGATGATGAAGTGAACCGCATGCACGAGAGTCTCCA
TCTCTTCAACAGTATCTGCAATCACAGATTCTTCGCCACA
ACTTCCATTGTGCTTTTCCTCAACAAGAAAGATCTCTTCC
AGGAGAAGATTAAGAAGGTCCACCTGAGCATCTGCTTCCC
TGACTATGATGGTCCAAACACATATGAAGATGCAAGCAAC
TACATCAAGACTCAATTTCAAGACCTGAACATGAAGAAGG
GAGTGAAGGAGATCTACTCACACATGACCTGTGCCACGGA
CACAAAGAACGTCGAGATTGTGTTTAACGCCGTGACAGAC
ATTATCATCAAAGAAAACCTTAAGGACTGCGGTCTGTTCT
AAACACCATCCACTTTTTCAAAGATCTTTCAGCCCCATCC
CCACCTAAATGATTGGATTTACTCTGGTGAAGCTGCCACA
GTAATAAAAGAACATCCACAGGTGGCATGAAAGTGAACTC
TACAGCAAGCAGTCAAGTGTGCTAAGTGGATCCCCGGCCA
AAACAACAACCTCCACATCCCAACCAAACCACAAAGACTA
GATCCAGATTAGACTAAATGGCCTCTGCTCTCCAAAAAGG
ACTCTAAATACATTTTGACCAACTGTTCAAGTCACTAATA
CAGTCAGTAAGAGAAGGGTTACCAAAGAAAGGGGACTTTT
GATGCTATGAGTTAATGGCGCTTGTAGAGAAGCTTCCTCT
CATTGTGTTTTAAAGTCAAGCCTATAGAGGTTGGGCTGTT
AGATGTTTTATTTTTCCATTCATTTCCAGAGAAAGAAAAG
TAAATTTAATGCAAAATAACTTTGCTGTATAAAAAACACT
GTAGTGGGAAATCAGATCGCAATTAGAAAGTTCTTTTATG
TACAGTGAGTAAAAAACGTGCATATAAATCAGCAAGACCT
GATTGTTTGAAATTAACCGGCTCACAAAATATGTGAAAGA
CTTTTCTTTTTCAGCCCCAAACACAGTAGGGTGGTGCGTT
TTTGTAAATAAGAGTAGGCAAATAAATTCTATATGAAATA
TAATATGGAAACCTAAATATATATATATATATATTTATGA
TACAGTATTACAGTAACAGTGAAAATTCTAGAATGGCCTG
TTGCTTTGTTTTAAACCTGAGGTCTGAATTTGTGGAGATG
TTCTGGAATGTAAATGTAGGCACATGAAATAAAGACTTGC
ATCAATTCCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations