Transcript

zgc:153293-201

ID
ZDB-TSCRIPT-090929-19078
Name
zgc:153293-201
Previous Names
  • zgc:153293-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038728 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038728|OTTDARG00000028444|ZDB-GENE-060825-315 zgc:153293|OTTDARP00000031019 CH211-272N13.6-001 LG_ AL954173.8 Danio rerio protein_coding KNOWN, 1298 bp
ACCAATCGTTATTCACGGTTGCCTTGATTGACGTGTCCAG
AGGGCGGGCTCAATGTGAAATGGGCGTGGCTAGACGGAGG
AAGCGGCTCTAGCATATCAAGCAAAACAAAAGCGATTCAA
CGAAATAATGCGACTAAACTGATCAGATGGTTTGCTGACG
ATGTCCTCTTTCCCGTCCTCCACCTCCAAGACTCTGTCCT
CCACGCCGCTGAAGAGCAGATCCAGCGTCCTGCAGCGCAG
TAGGAGTCTGGAATCCAGTGGCGGCTCCACCTCCTCTCTG
ATCTCTCCCATCTATCACGACAGCTTCGATCATTCAGAGG
ATGAACCAGAAGATCACTTTCAGCCTATTCGCAACCTCAC
CATCACGCTAAATGAAGACGCAGCGCCGCTTTCTCCATCC
AGGGGTGAGGTGAACACGACAGGCCTGGACGACAGACTTT
CCTCCAGTCAGATGAAACTGAGCGCCTGGGAGCAGTGGAT
TGTGGCTAAAGCCAAGGAAGAGCGCGTCCGAAAGCAGCAG
AAAGCTGTGGAGGAGCTCACGCTGAAGGATAAAGAGAAGG
AGAAGGAAAAAGAAGAGCAGAAGAAGAAAGTCGCCAGTGA
TTGCAAAATTCAAGAGTGGCTGCAAATGAAACGAGAACAG
GAAAAGAAAGACAAGCAGTCCAGAGAGTCTCAGAAGAGCG
AGAAACAGCTTAAAGAAGAGCAAAAGCGAGGGGAGATCGA
GAGAAGAGCTCAGGAGAAATATAAAGAGTGGCTGCGGAAG
AAGAAGCAGGAGGAAGCTGAGAGAAAGCTGAGAGAGAAGG
AAGAAGCAGAGAGAAGACTAGCGGAAGAGCGGGAGCGGAA
AGAAAAGGCGGAGGAAAGCTTTAAAGAATGGCTTGATGGG
GTGAAAAGCAAACAGAAAGTGAGCCGACAGTCTTCAGCAT
GCTCAGCCGGGAGCTATAACAATGTGAATTATCCGTCTCC
GAGTTTCGTCAACCCCATTCCCTGGAAACCCATTCATGTC
CCGAAGCAGGAGCCATCGGCCCGCAAGAGTTCATCTCGGA
GGAGAAAAACAGGACCAGCCAAAAGCCAATCCAGCTCCTG
CTTCACTTACAGACCCAAAGACACCATCAGTTTCGCCTGT
AAGAGGCGCTGATGCTGCCATCTGCTGGACTCTTATTAAC
ACTTGCTGCGTTTTTATCAAGCAGAAATTGATGTTTTTGA
CTCGATGAGTTGACTCGTGTGTATTTTTGGTTGAATGTTT
GCTAAATATGAAAGCAGATGATTTTTCTACTCCAAATAAA
AGATTTTTGTAAATGCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations