Transcript

tnfsf10l3-201

ID
ZDB-TSCRIPT-090929-18815
Name
tnfsf10l3-201
Previous Names
  • tnfsf10l3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038432 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038432|OTTDARG00000028268|ZDB-GENE-070606-1 tnfsf10l3|OTTDARP00000030801 tnfsf10l3-001 LG_ BX511168.5 Danio rerio protein_coding KNOWN, 980 bp
CCGCAGCCCCTCCTCAGCGCGTGCTGGACTCATTCGACAG
GAATGCCGCCGCATCCGAAGGAAACTCGGAATATTTACAA
TCTGTGAGTAGCGAGTCGAGCTCATTCATCATGGTGCAGC
CTAAAAATCGTCTCGAAGTTCCGTCCAAGATGTGGGTGAC
GACGGTTGTGGTCATCGTGATTGTCCTGCAAGTTGCATCG
ACCACCGGACTCTTCATATACTTGAACATGTCAGTGGCAC
AGGCTCGAACACAAGGAATGGTGGAGGAGCTGAGGTGTCT
TGGTCTGCTGAACGCTATGGAGAAAGAGCAAGATGTACCC
GATGATCTAGTCCAGCTCTTTGGAGAGCCGTGCATTAAAC
TAGCAGAAGGACTCAAAGCCTACATCTCTAAGGTCACAGA
AAACATAATCTCCAAACACACCTTTGAAGAAAGAGTTTCT
TTCCCACCAAGGACAAAATTACTCACCACTGGCAGCCCAC
GGCCGTCAGCTCATCTTACTCTCAGAGACAGTGGACTGCA
GGGTACAACATCCCTGACCCCTCAGATGGACCTTCACCAA
TCTTGTCGCCATCCCGTTCGTTCCTGGGGAAACCAGAGCT
TTGGTTCCCACCTGCACAACATGACCGTGTCTAACGGCCG
CCTACGCGTCCCTCGAGCCGGCCGCTACTACCTGTACGCT
CAGGTCTACTTCCGCTATCTGACCCTCTCAGTTGACGATT
ACCACTCAGGCTCCGTCAGCCATCAGGTGGTGCAGTGCGT
CTACAAGAAGACGGCCTACGCTCGCCCTATCCAGCTCCTG
AAGGGTGTGGGGACCAAATGTTGGTCTCCGGACAGTGAGA
ACGCCCTGCACTCCATCTACCAGGGAGGCCTGTTTGAGCT
GCGAGCAGGAGATGAGATCTTCATCTCAGTGTCGTCTCCC
ACAGCTGTGTATGCAGAGGACTCCTCCAGCTACTTCGGGG
CCTTCCTGTTTGACCTCTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations