Transcript

gpr146-201

ID
ZDB-TSCRIPT-090929-18456
Name
gpr146-201
Previous Names
  • gpr146-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038062 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038062|OTTDARG00000028077|ZDB-GENE-050823-3 gpr146|OTTDARP00000030505 gpr146-001 LG_ BX936313.8 Danio rerio protein_coding KNOWN, 3695 bp
TCCAACGGCGAAAGTTTGGCTCATGAATATAAATGAACAG
TGTTTGCCGTAGTAGGATTTGATAATTTTTGCAGTCGGGT
CTTTTGAAGAGGACTGTGGGGGAGGGTCACGTGACGTGTG
TACACACACTGTAGAGTTCAGCACCACTCGACTCGTAGTA
AGATCATCAGCGTCCTCCCCTTTCCAGAACAAGCGTTGAC
GGACCAGAGACGAATTTACCATATGCAACTGTGTTTACGC
CACATCTCGGCGCCTTGATCGATCGCATTTTACTTACTTT
CTTTTACACGCAGTCCGGGTACTTCTGCTGCCGTTTTAGG
AGCTTTTGGCAAAGTATCCGAGGAGAAATGTCAATGGAAA
TACAGCAGAACCCGATGCCTCCGTAGAGCTGTCCGAGTGC
CAAGAACTGGTCCTCTGCTGATTCAGAAAGACAGAGCAGA
AACCATTGGACGTATAGCAATGTGGAGCTGTATGGTTTAC
AATGAGACGGACGACAATGTGGACCTCAGGCTCTGCCAGG
ACTTTGGACTCATCTTGTCCGTCTTCTCGTTGGTGTACCT
CATTGTCTGCTTTCCAGTGGGCCTTTGCTACAATGCCCTG
CTGGTGGTGGTCAACCTTTCCAACAAGGTCACCATGACCA
TGCCCGATGTCTACTTTGTGAACATAGCCATCGCTGGCCT
GGTGCTCAACTTGGTGGCTCCTGTGGCACTGCTGGGCCCC
AGTTTCACCCGCTGGCCCATGTGGGAATACAACAACGAGA
TCTACATCACCCTCCTCATTCTGTTCAACATCTCTTCCCT
GGTCATCATGTACTCCACTACCTTGCTCAGTCTGGACTAT
TACATTGAGCGCGCTCTCCCACGCACCTACATGTCCAGCG
TCTACAACACCAAGCATGTTTGCGGCTTCATCTGGGGCGG
CGCCGTCCTGACCAGCTTCTCCTCATTGCTCTTCTACGTG
TGCAATCACGTGTCCACTAAGATCATCGAGTGCTCCAAGA
TGCAGAACAAAGAAGCGGCTGACGCCATCATGATGTTCAT
TGGGTATGTGGTGCCAGCAGTGGCTGTGCTTTATGCATTC
GTGCTTATCCTACGCATCAGGAAGGAGTCCACCCCTTTGG
ACCAGGACTCTGGAAGGCTCGATCCTTCCATCCACAGGTT
GCTTCTGGCTTCCGTGTGCATGCAGTTTTTACTTTGGACT
CCGTATTACATGACCCTACTTGTGCACACAGTGGCAGGGG
CTCCCGGAAGCCATTCCAGCAAGCAGCAACTCATCATATA
CTTCTTCCTGAGATGTTTGTCTAAACTTCTCGCCTTCTGC
AGTAGCTTTGCCATTCCTCTCATGTACAGGCAAATGAACA
AGAACTTCTCGCATAAACTCCAGAGGCTTCTAAAGAGGCT
GCACTGCGGGGACCAATCATGTCCTCACGAACGCTCGACA
GTTCAGCAGGTGGTCACATGAGGATTGTGTTCAATCAGAC
CTGCTTGTCCCTCACTGGCACTTACTCTGAATCCACAGAA
GTAGAGCCAGCACATGAACCTGGATATATATTGTGCTCCA
AAAAGAAAGGAAGTATTTCGCTTACCACAAGGAGTGTCTC
TGTGAAATTGTGGAACCTCCATAACACTTATCGACTTGAC
TTTATTTGTCCATCTCTGTGGTCAATGGACGACCAAGAAG
AAACCACTAAGTGCTGTTTTTGTGTAAGCTGTGTCTATTC
TTTGGGTTCTAATGCTTGGGGAATATCTCAACCCGTCTGT
TGGTCCTTTCAGTAACAGGGGGTTGGATGTTGAACGTGTT
TAATCAGTTACAGGATATGTGGTATAGCCTTTTAACGTGA
TGCTTTTAGACCAACTTTTTCCCTTTTAGTTCAAGGCCGC
ATTCTGCCCCAGGCTTTCTTTCTTTCTTTCTTTGCACCAT
AAGCTGTTCAGTCTAGAGTTTTCAGGTCACACTTTCCATA
AAACCTCTCGGGTAGATGCTAGTAAACGCAATATAATTAC
CTCAATTTCACACACCAACGGGCATTACATTGGAACGGTC
TAACCAACTTTTACAGCACCCAGAAATAGCTCGACGAGAC
TGATATCAGGGAGCGGGAAAGATGTGTTTGCGTGCGTGTG
GTTGCCTGTCGATGGTCGTAAGTGTGTGTGTGTGTGTGTG
TGTGTGTGTTCTCGAGTGCTTGCTGCTAAGGTGATGTGCA
TTTTTACTGCACAGCTGCTCAGCCATAGTAATTCCTGTGT
ATAGAGGAATTGAGACAAAGCTATAGAAACTAGGCAACAG
ATCACGGTTTTAAGGTCAAATAGTTAGAGATGTTTTGTTT
TTAAATACCTTTTCAATCATTAGTCGGTTACTACTGGAAT
TATTATCAGTGCATCATGAGGAAGTGGTTGACAATTTATA
TGAGGAGTGAATCCAAGTTCATTTGATAAAGCAATACTAC
CCTGCTGAAAAATCCAGCTTAAACCAGTCTAGGCTTGTTA
GCTGGTTTTAGCTGGTAAATAGCCTGGCTTTAGAGAGGTT
TTGGCCATTTCCAGGCTTGTTTCCAGCCATTTCCAGCCGG
GTCTTAGCTGGTCAGGCTGGAAAATGACCAGCTAAATCCA
ACTAAAACCAGCTTGACCAGCCTGATTTAAGCTGGACATA
GCTGGTTTTGGCTGGGCTCCCAGCCTGGCTAGGCTGGTTA
AACTGGTTTTAGCTGGTAATCTTCCAGCCTAACCTGCTAA
GACCAGGCTGGAAATGGCTGGAAACCAGCCTGGAAATGGC
CAAAACCTCTCTAAAACCAGCCTGATCTACCAGCTAAAAC
CAGCCAACCAGCCTAGGCTGGTTTAAGTTGGATTTTTCAG
TTGGGTATCTATCGCAGGGTTGCCCAAAGTTGGTTTTGGA
GGGCCAGTGTCTTGCAGAGTTTAGTTCCACCCCCAATTAG
ACACACCTGAACCAGCTAATCAAGCTCTCCCAAGTATACT
AGAAACTTCTAGGCAGGTGTGTTGAAGGAAGTTGGAGCTA
AACTTTGCAGGACACCAAGTTTCGGGTGATTTCCGAAAGA
ATTGATTGGACTTGAGTTCTCCTAATCAACGAATCCTATC
AGTTCTGATGTGGATATGCTAAAGAAATCGCTTGTATTGA
GATTAGTTGCATGAATGATTTCATTATATAGAGAAGATAT
GCATCAGCGCTCCCAATCTGGGAGAAAATCATAGACTTTT
CCAGAAAATAATACCCAAGAGGCGGGATGAGAAATAGTTT
ATGCTAGTAAATGGTATGTTATTATCAAAAAAAAAAGACA
TCTTTGCTCTTATTTTTCTCGAGTGGATGCAGAATAAGTA
TATTTTGGACAGAAAGCACTGTATGATAATAGAAGAGTGG
AGAGGGGTCATTTATATCCACTTATATGTGTGCAAGGGAA
AGATTGTATTTAAAGTCGCGAAGGGGATTAAAAACAGTAA
CCCTCAATTATAAATGGTGAAATGGCATCAAAACGCAATG
TTATGGCTGTTGTTAGCGAGCTAATGCCAGTATGTATCAT
ATTACGAATGTGTATATATTGTACTTCAGAGATTTACTGG
AAGAAAAACTAAACAGACATGCCATTTTAGGTTACAGTAT
TATTTTCGCAGAGATTTATTTAGATACTAAAGTGTCCGTC
ATCCTCTGTCCCATACCGAGTCAAAGACTTGTTCAATAAA
CTAACATGAATATAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations