Transcript

abhd14a-201

ID
ZDB-TSCRIPT-090929-1835
Name
abhd14a-201
Previous Names
  • abhd14a-001
  • zgc:85972-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000010829 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000010829|OTTDARG00000009445|ZDB-GENE-040426-2428 abhd14a|OTTDARP00000009322 CH211-231A1.1-001 LG_ BX908398.10 Danio rerio protein_coding KNOWN, 1361 bp
TTGGCGCGACAACCGGAACCATTGCATTCGGTTTCCACCC
GGAACTGTTATTATGTGAGACGCATTAACGCTCCGCTTCT
GACACTATAGTACATGCGAATAATGATCAATCTCAAACTT
TCGCACACTCACCTCTCACTGGACATTTCTTTTACCTCTC
ATAATTTATAGATGATGAATTTCCTCCGCAATCGGCTGGT
GGTTTTGGGGCTGGTGCTGCTGGCCACGGTGCTCCTCTAC
CTGCTGCTGCCCTCCATGAGGCAGGGCAGTATGGAGCCCT
CGCTGGAGGTGCAGCAGCGGATGGGACTGATGGCCGCGAC
CCCCCCTCCGCCGCCGCCGCCGTCCAGCGTCAACATCACG
GTGAGGACCGGACAGCTGCCCGGTGACCCGCCGCTCTTCT
TCAGGGAGGCTCTGCCCGTGGACAGCGCGGGACGACAGAT
TCTGCCCAGGTTGCAGATGGTGCTTCTTCATGGTCAGGCC
TTCACCTCTAAGACCTGGGAAGAGTTGGGGACTCTCAGTC
TTCTGGCCTCCAGCGGATACCAGGCCCTCGCTCTTGACCT
GCCCGGTTACGGGAATTCTCCGGACTCGGAGTCTGTGAAG
TCGGATCAGTCTCGTGTGGATCTTCTGAAGCGTTTTCTGG
AGGCTCTGGGCGTCCGAGCACCCGTGTTACTGAGCCCGTC
GATGAGCGGTCACTACGCCCTGCCGTTCCTCCAGAGACAC
AGCGCACAGTTACATGGATTTGTTCCCATTGCGCCGGTGG
GCACCCGAGGCATCACCCCACAGCAGTACCATGACATACA
GACTCCTACACTGATCATATATGGGGAACTAGACACCAAC
CTGGGTGCCCAGTCTCATAAGAACCTGATCCAGCTGCCCA
ATCACACCGTGGTGAAGCTAGCAGGAGCGCGACATGCCTG
TTACATGGACAAACCCCGCGAGTTTCACCGTGCCCTGCTC
GACTTCCTCAGTAAACTCGACTGACGCGACGGCACAGCAT
AAAGCTTGTGTGGAAATGACTTTGGAAGAGACTACGAGAA
GAAAAAGAGAGGTACAAGTAAACAAAAAAAAAGTTGAACA
GGACTGCAGCGTAGCCGAAAGAAAACTGTCCTGAAACCTA
ACAACACTGAGCTTTCAATCGACCATCCACATCAGCTCAC
TTGTTATTATTTCCCCGCGTGCACCATCATGAGACTTTAT
AAAATATCGAACAAATGCAAAATTATTATAGTACAGATTC
CTTTGTAGATTCTATGCTGTTCCTAAGGATGATTCCGGAA
CACTTTAAATATCATTCTCTAACAAATCTGAGGGATGTTG
TTAAAATGCTATTATTAAAAACTGTGAACATTCAGAAGTT
A

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations