Transcript

rhoub-201

ID
ZDB-TSCRIPT-090929-18210
Name
rhoub-201
Previous Names
  • rhoub-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037813 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037813|OTTDARG00000027936|ZDB-GENE-050417-308 rhoub|OTTDARP00000030309 rhoub-001 LG_none CR847977.7,CR925772.23 Danio rerio protein_coding KNOWN, 4077 bp
TTGTAGAGCAAGAGAACTTTCTAGTTGTCCGTGGAGACCT
TCTTGAGTGTTTGGGATTTATTGACTGTTTACACGTCTTG
CAGCCAAGCAAGCGTATTCACGCAGCGCTCGTAGGGGCCA
GTTCTTTATAAAGTGCTGTTTTTAATGTGTTTTCCTCGGG
TCACTCCATCGGGAGTGCGCGAGCCACCTGCGGTCCGGTC
ATGGATTACAGTAACCTGATGGCGCCTCCGGTTCCCCCGC
ACATGCCCCAGTCTCCGTCAGCCGCGCACTGCCAGGGCCG
CCTGCTTAAGTGCGTGTTTCTCGGGGACGGGGCTGTGGGA
AAAACCAGCCTCATTGTAAGCTACACAACCAATGGATATC
CAACAAAATATGTCCCGACAGCGTTTGACGACTTCTCAGC
GGTCGTACAGGTGGACGGTCAGCCAGTGAGACTGCAGCTC
TGTGACACTGCAGGACAGGATGAGTTCGATAAGTTGCGCC
ACTTCTGCTACACGCGGACTGACGTTCTCCTGCTGTGCTT
TAGTGTGGTGAGCCCCGCTTCCTTCCAGAACATTGGTGAA
AAGTGGGTTCCGGAGATACGACGGCGTTGCCCGCTCACCC
CTGTGATACTAGTGGGCACCCAGTGTGACCTTCGGCAGGA
CGTCAAGGTTCTTATTGACCTTGCAAGACGCAGAGAAAGA
CCTGTTCTGGAAGAGGACGCCCGAGCCTTGGCCGACAAAA
TAGGAGCAGTGTCCTACATCGAGTGTTCTTCGCTCACACA
GAAAAACCTGAAGGAGGTGTTTGACGCCGCCATATCTGTA
GGGCTCCGACATTCAGACAGAAGAGCAAGACGGGAACGGA
AGGTTCACAGTACTGCTGATAAAATGAAAATGCTCTCAAA
GTCATGGTGGAAGAAGTATATCTGCATACAGTAGCCGAGG
TCTTCTGAGGTGATGAACAATGTGATGGACTCTTGCTCAG
CATCACGCTCCTCAGGTGGATGATGCTCAGTTGATCATGA
ATTGGCAACAGAAAGTGTGCTGGTAAATTACCTTTCATGG
GATAAAGATTTTCAGCCCCTAAGGCATGGAGTAGGCGAAG
AGGACTGTGTTGCCTGTGTTTTCAATGTTGGGATTAGGGT
TGCAAAATTCCAAATTGTCAAATCTGGAAACTTACCATGG
GAACTATTGGAAATATATGGAAATTACAGGGAATAAACTG
GGAATTTACAAAAATCCAGATTATCTTATAATATGTAGCT
GTATATATTTAAAATATATTCATCAATCACATACCCTCAC
GGGAGAGGGGGATTCTTACATCCACTTTAAAATTAAAACA
AATTTCTGCAATTAAGTGTAAACATTACAAACATTCAAGT
AGGTTTTGACATTACTTGGGTAAATAATAGTGTTATAACA
CAACTAATACTACAACCCTGCCGGCACAGGACGTCGACAT
GATGTCATATTGATGTTGTACCCCAACGTCATGGGGACAT
TGGATTTCCTTTGGAAATGAAAATCGGGTTGAACTCAGAA
TCCAACATCAGGTTGACATCAATGTCCAACATCCAACCTA
AAATCAATCAAAAACCAAACAAATATCATCGTCTACTCCT
GTTACACCTTGAGGTTGTGTGGACTTTACCAATATGACAT
CTATCAGATGTTGGATTTTGGTCAACAAATCTTAAAATCA
ACTAAATATCAACATAATTTGACGCTGTTATTGGACGTTA
AAATAACGTTGTCCTTAGAAGTTATCTTGACATTGAATTT
TGGTCACCTGACGTTATGGCCTAAATCGAACCTAAAATTA
ACGTCTTATGATGTTGTGTGCCTGCTGGGAAAGTAGTGCT
AATTGTAAAAAAAGCACCCTTTTCTTTATATTAACCCAAG
CTAGTGCTTCTGTCTTCCCCTTGCCAGTTTTCATACATCT
GCACGGTATACATTACTATTTTTAATGTTTATAATCTTCA
AGGCTGAATTTATTTGATCAAAGATACAGAACTGAACATA
TTACTAGCCTATGACCAAACAATTTAGCTTCATATGTGAT
GCAGTTTACATTCCGCACATTTCAAATTCCTGTAAATTCC
CTAAAATTCCCGGTAAGTTTCCAAATTGGAAAGTTTCCAA
AATGTTGCAGATGAATTTACTATGAAAACCTTCTGGAACT
TTGCAACCTTTGTTAAGAAGCCATTGTTTATGCTACTGTT
TCTGGAAATCAGTCACTGGTTCCACCCTTTTAATGACATC
ATGCATGTCATTAAATGCAGCAAGTGTTTATCGGTTTGAC
GGTCAATTGACAGAACTTTAACAACAGATCGCACTCAAAG
TGAGCGTTGGTATCACGCCAAAAACATACGGACACCACAT
AACATGCCAAACGTCAGACAACAGCTGGTCTCTTACCTCT
ACCGATTCAAATTTAGATGTTTTTGCGTCAATCGTGATTG
GCAGAGATAATATGCATCATCACAAGGTGATTATGATTGG
CAGTCCTGCCAGCCAATAGTGCTCCATACATATGCGGTAC
CTAAATGTGAAAGTGACAGGTCATGTAAAAAGAGAGAGAA
AGAGTTAGAAACAACTTACACACACAATATACAGTGTACG
GTTCACAAATTTTCATATTCAAAATTGCATAATATTTACA
ATATTATGTAGTCTAAACTTGGCATTAAAGTCGAATTTTG
AAATTGATTCATACTGGCTACATTTCTGAATGGGAAATAA
TAAATGTAAAGGAGTGTGATTGGAAGACTGGACTTCAATG
CATATCATCTCAGAGGCTTTAGCTACTTAGAAATGTCTGA
GCCAGATTTGTTTTGTCTTTTAAAATGATCCCCAGATCTC
CAAATTTTTTCTTGATTTTGCTCCAAATAACTCGTCAGTT
GTGTTTTATCTGCACTCTGAGGCAAAATAGAGCTATAGCG
GTTTCCCTGGTCGCAGTAAAATTTAATGGTTTGCATCAGT
TTGCCAGAAGGACACAGTTTTGTTCATTGAACACATGGAA
ACTCTATTAATTGCTAGCCTAATGTTCATATTTCTGCTGA
CACTCAAAATGGCTGAACTGGAACACTGCTGACCTCCTCC
ACAATCAACACCATATGATTATGGTTTCAAAAACCATCTA
CTGTTTTCATTTAATAACCAAATACAGTGCCACACTTTCT
AATTTATGTCTTCCACCTGATAAATGCATGTGCAAATGTT
ATGTGACTATGTTAATGATGCTAGCATGCTAACACTGGTG
ATTTAAGCGCTTTTTTTTTGTTTGTTTACCCTCCATTTCT
GCAGTTTTATAGCAGTCACATGGGCACTCCAAGTGGAACA
TATATGCCATGATGTTTAAGTTGTCACTCAGCAATCATTT
GATCATTTTGATTGTCCATAAAGGGTGTAATTACCCTTGT
ATCCTGGTAAACACAGTTCCGCGATGTGAAATGTAGGTTT
GGGGAACAGTAGAGCTACAGTATGATTAGCTTTATACGCT
GCAGTGCACTAGACTTGATCTATACAGACGTGCCATGTTG
TAAAAAGTCTAGTACAAAGTTCTTTGGTTATGTATCCTCC
TGTTTAACCAGCAGTGATGGGGAGGATCGGCCAATGAGCT
GTTGAATTTGCTTCTCATTATTCAGAAGCCCAATCAGAAT
CAATCTGCCAGAGATCGGAGCGCAACAGTGAAGTGACTGC
ATTGTATTTTCTGTTTTAAAACATTAATCTGATCAATTTT
ATATTGTCATGTTGGCAACAGCATTTCAATGTGTTTATTT
TTAAAGTCTTTTTAATTAATCTGCAGAACTGAGAAAATTA
AATGAGGAAGATGTTTCCTCCTAGGCCAAAAACCGAGAGG
TCGTTCACTGTTGCACTCTTTACAGCTACACATCATCAGG
AAATGGCCTCTGACCTTTATGTTTAACTGTCAGCGTGATA
ACTTTATCAGGGTAATCTACTTTTAGATTTGTACATTTTA
TGATTGCATTTAAATTTCTCTTACTCTATAAATGCTCCTG
ATTTGGTACCGTATGTGTGAGAGTGTGTAACTGCTATCCA
TGATTTTCATGGAAAATAAATGTGACATTAACTGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations