Transcript

zgc:66448-201

ID
ZDB-TSCRIPT-090929-18145
Name
zgc:66448-201
Previous Names
  • zgc:66448-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037745 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037745|OTTDARG00000027890|ZDB-GENE-030131-5612 zgc:66448|OTTDARP00000030255 CH211-261D7.1-001 LG_ CU062628.8 Danio rerio protein_coding KNOWN, 4260 bp
ATGTGAAAAATGGCTACTGTACAGTCTGAATCCGAGCAAC
CATTAGACAATAAACTCATTAACGGAACGCTCGCTGGAAA
TAACGCCGAACTACAAGCTCCGTCTGCTGCGGCCGCTGAT
GGGGACGCGGTGGTCTGTGCACAGAGCACCGATATAAAGG
GAACAACAGAGCCTGCTGCTCCGTCTTCACCAGCAAGTGA
AAATTCACCTCCACATGGCGCTGCTCCTTCACCAAGCAAC
AAAGATGCATCAGGAATGTCGTGTAATTGGACATCTGAGG
CGGGCGAGCAAAACACGGATGTGCTTTGTAAGGATAACGG
CGAGCTGTGTCCAGACGAGCCCGGAAGGGACTTTGGGGAG
ACGTCGGGTGTTTTGCACAATGAAAACACTGGGCAAGAAG
AAATAGACAAAGAAGAAGAATCAGTAAACACAACTACAGA
AAGAATCAGCAACGATTCAGAGCTTGTCACAGAGAAGGAA
CACCAATCAAAACAAGATGAGCCGGCAAATGGGAGCGAAA
AATCAGTTTGTGTTGTGGAGGATAAACACCCACCAAAACA
AAATGATGAGCCGGCAAATGGGAGTAAAGGATCAGAATGT
GTCATGGAGGATAAACATCCACCAAAACAAGATGATGAGC
CAACAAATGAGAGTAAAGAATCTAAGCATTCCAGAGAGGA
AGAACAGCAACCTAAAAAAGATGAATCGGCAAGTGTTGAA
GAAGAATCAAAGCCTCAAGATGAGACCATGCAAAGCACAG
AGACGAAGATGGACGAGACCACGGAGAAAGATAAGGACAA
CACAGAGGAGAAAGGAGGAGGAGATGAATCCAAAGGTGAT
GGGACAGGTCGATCTATCAAGCGAAGGAAAAGCCGAATGG
AATGCAACGAATGTGGTAAAAAGTTCACTCGCCGCGAAAC
ATACAACCTGCATCGCCACTTTCACATGCACCAGGATGAG
CAGGCGTCCCTCGTTTGTAAAGAATGTGGCATCACTTTTC
AGCATCGAAGTGACCTCATTAAACACCGCAGTATTCATAA
AGAAAGCAGCCAAGCAAGTGTCTCACCTTCGAAAGGCTCT
ACGAGCATAACCAAGGAACGGAGGAAATTTGTGTGTGAGC
ACTGTGGTGTGTGTTTCTCAACAATGATCCGATTAAAAAT
TCATGCCTGTGAGCAGAAAGTGGACAAGCCATTTCGCTGC
CCTCTGTGCCGCAAAGAGTTTCAGTACAGGGTGTCTATCA
ATGCCCACATGCAAAGTCACTCTTTGGACAGTCGCTATCG
GTGTCTGGAGTGCAACAAAGGCTTTCAGAGTTTGGAGAAC
CTGTATGTCCACCAACGGTCTCACACTGCGCTAAAACCGT
ATGAGTGTCCAGACTGCAACATGGTCTTCAGGCATCGCTC
CATTATGGAGGACCATCGGCGCAGACATGTGGATGAAAGG
GAGCACATGTGCAAAATCTGTGGGAAGAACTTCAAATACA
GTAGTCTTTTGCATCAGCACCAGTATCTCCATAGTGGCCA
AAAGCCTTATCACTGCTCGCACTGTGGCAAAACATTCGCT
TTTGCACAAAACATGCGAGCACATTTTCGCCAACATAAAA
AGATCTCCGCTAGGTCTGAAGCACATAGTATAAACCATAA
TGTATCTGCTGTGGGGCAAGTAGGTAAAGAGAATGCAAGT
GTTGAGCAGCAGCGCAACTGTCCACTGTGCCCTCAAATAT
TTTACAAGGCATCTGATCTGAGATCACACATGTTGATTCA
TGAAGCAGAATATGAAAGAATGACTAATGGCAAAAAATTT
GATAAGGTCTATGCATGCCAGTGCTGTTCTCTCAAATTCC
AGACAGAATCCCAACTACAAGCGCATTCACAAACACACAT
GACAAACATTTTAGGCATAAACGCGACACATATCACGAAT
CAGGTGAAAGCAGTACTTGAAAAGCAGGATGATGTTGCTG
TGGATGAGGCAGATCATGACCGTGTGTCAGCAGTGGGGGA
ATTGGAGGACCAGACAGGCAAGAAACCCTTCAGGTGTCGA
GACTGTGGAAAGTGCTTTCGTTACCGGTCAGTATTAGAGC
TGCATATGCGCATACACAACAAGGGTTACCAGTGTCAAGT
GTGTAAAAAGTCCTTTAGGTTTAGTAGCTATTTGCAGCAG
CATTCGATTATCCACACTGGGAAGAAGCCGTACAAATGCC
CAGACTGCGGTAAAGATTTTGCATTTCATCATAACATGAA
AACACACCAACGGCTGCATCAACAAAAGCCATTTCGCTGC
ACACAGTGTCGGAAGGGATACAGCGACGAAAATCAGCTTC
AGCGACATATGCTTTCCCATACAGGTGAAAAACCTTACAA
GTGTCATATGTGTGACAAGAGCTTTGCTTTGGCCTACTTG
CTCCGAGACCATCTGAACACTCATACGGGGGAGAGACCCC
ACCGCTGTCAAGAGTGCCACAAGTCATTCCCTTGGCTCAG
TAGCCTGCTTGTGCATCAAAAGATTCATGTGCGAAAGCGT
CAAGGTCCGAGTCATAGTTACTCATTCTCCATACATTCTC
AAAGAGGTAGAGTAGGCCCTGGCAGAAGAGGTAGGCCGAG
GTTAGATCGAGACAATGGAAGGACGCCGCCTCTACCTGAT
AGAATCATACCAGAAACAGTGTTGCCAAATGTGGTTCAGC
AGCAGTTTGGTACAAATAGAGGACCACAGCCGGGGAATCA
TTCGCAGCAAGTTCAGTTACAGCCAGAATGGCAGATACAA
ATTGCACCATCATCATCAACATCGTCAGAAGAGCTGCTGC
ACTCGCAGAAGTCCGCAAGTTTAATGGAAGCCCAGCCAAC
TAATACAGTGCATATTCACTGGACAGGGACTCATCATAAG
ACAATATTGCCTAAATGTGATGGTCTTCCCGAGCTCATGC
ATCAGCAGAAATCTCCTCAAGCACAACCTAATCACTTCTC
AGACATAAATTCATCTGAGATAGAGCAAAAAGGCAAGCAT
CCTGCACTCTGGATGAATGCACCAAACTCTACACTGCAGA
AAGCCTCTTCAGAATCGCAACACCACATGGACAGGCCTTC
CACTTTTGGTGTGAAAATACAGTCCCAGCGATCTATTCAG
GACCTGCAACCATCGCAGTGGCCAGTTATCTGTGATCCAT
TGCAAACAGGCAAGCCAGAGCTGTTTAGTAACTCCTCAGA
TGGTAAAGGAACTGTTGATTTAGAAGCACCAACCATCGCC
GACTCTAATAAACTGTCTCATGATTTACAAATGCCTGATT
CATCTGGGGTTGCTACATCAGACATGGGTAAAACTAGTGG
TATTGTGCTGTCTACTGGTGCTTCCTGCCTACCGAATACT
AATCCATGGGGTATGAAAACAACTCTAGAAATGTCTGTAC
CTGTGAGCTTACAAGAATTACCTGGGGATGCATTAGAGAA
GCAGCAAAACAGACTAATACAGCATTTGCCACAGCAAATG
CAAATTTCACAGCAGCTACAACAGCAGATTCATGTGCAAC
AAGCTCAGATACCTCCTACTTGGGTTAGTACAGGTCCTCC
AACCCAGATAGGACCAGTGAACATGCCTTTTTCGCCACCT
CGTTTTCCTCTTGGGGACAGACCTCCATTGTGGGGATTTC
AAGCTGCTCCAGTTGTTTCTCAAACCCTTGTAAACGGGCC
AGTTCCACAAGGCCACATCCAGGCACAACAACACGTAGCA
CTAATTTCTGGTCCACGTATTCCACTTAATCAGCCTCCAA
CTTATATCTCGCCCCCTTTTCCTCCACCAGGTCTAAATTT
ATCTGCTCCACATCCAATGCATTCTGTTGGAAGGCCTCTT
CAAGGTGCATTGCCTCAAGGCATCTTCTTCACTTCACAGG
GTACCATAAATGAGATGGCACTTCTGCCACAAGTAACAAA
CTTACCTCAGTTAGCGCAACAAACTGAGCCTCACAAAATG
GGCAATAAATTACCTTTCGCCCCAGATCACCTGTTCCAGT
GCATGATTTGTGGTTGTTCTTTGCCTGGAGAACTAGAATT
ACAGATGCATTATATGCAACACGCACAGCGAGACGTCTGA
GTTTGATTTTTAGAAATGATATACACACAAAATAAAAAAT
TAGGTGGTTTAGATTGTCTATCCATTGATTTACTGTACAT
TGCTGTTGTACATTGCTGTTAAGCTGCTGGAGTGTTTGTT
TAAGACTTAAGATGTATTCATGTTTTTATTCAGTTATTAA
ATTTTCCAGCGGAACACCTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations