Community Action Needed: Please respond to the NIH RFI
Transcript

mrps6-201

ID
ZDB-TSCRIPT-090929-17994
Name
mrps6-201
Previous Names
  • mrps6-001
  • zgc:153390-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037590 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037590|OTTDARG00000027798|ZDB-GENE-060825-59 mrps6|OTTDARP00000030128 CH211-199I24.3-001 LG_ CR854925.5 Danio rerio protein_coding KNOWN, 771 bp
GAACTATCACTTTGCTCCCGTGCTGTAGGTGGCGCACTGC
ATCAACCCGCGTGTGTTTCCAGTGTCTCCTTGAAGAACAC
ACACATGCACACTGGTATCTGAGACACATTTTAGCTTGAT
ATAAACTCTGGCGTTCAAAGCTCCGGAGGATGCCTCGGTA
TGAGCTGTATATGGTCCTGAAGGCGATGCAGAGGCCGGAG
ACCGCGGCTGTTTTGCGGCGCACGGTGGAGACTTTGTTCG
AGCGCGGCGCGGTGGTCCGGAGCCTGGAGAACCTCGGTGA
ACGCAAACTACCGTACAAGATCTCCAAACACGACTCTCGG
CAATCACACGGCGGATATTTCTCCATTGACTTCCACGCGT
CGCCGAACATAGTCAGCGGGCTGTTGAATCACCTTGAACG
GGACGTTGACGTGCTGCGTCCGACGGTAGTAAAGAAAGAC
ACGGAGCTCCCCAAAGGACAGTGCTGTGGAGTAGCTCGAG
AAGTGAAAGCAAAGATGGCCAGTTAAATGGCTGTGAAGAT
CGCCTCATCTCCTGGATTTTGTGAAGGGATTTTTGCAGCA
GGACGAGCTAGTAAACGCCAGCATCCATTATACAGTTTTG
GAGAAGTGGATTTACGTCAGCTAATCATGTCATGCGTGTT
TTTGTTTAGAAACTGTGTATATATATGATCTCTTGGCAGG
ATTTTTTTCATTGAGTATTTAATTTCAGTGTAACAATATT
TGATTCACAATTTCATGCTCTGAATTAATTAATAAAAAAA
TATTTAAACCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations