ZFIN ID: ZDB-TSCRIPT-090929-17994
Transcript Name: mrps6-201
Previous Names: mrps6-001, zgc:153390-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037590 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037590|OTTDARG00000027798|ZDB-GENE-060825-59 mrps6|OTTDARP00000030128 CH211-199I24.3-001 LG_ CR854925.5 Danio rerio protein_coding KNOWN, 771 bp
GAACTATCACTTTGCTCCCGTGCTGTAGGTGGCGCACTGC
ATCAACCCGCGTGTGTTTCCAGTGTCTCCTTGAAGAACAC
ACACATGCACACTGGTATCTGAGACACATTTTAGCTTGAT
ATAAACTCTGGCGTTCAAAGCTCCGGAGGATGCCTCGGTA
TGAGCTGTATATGGTCCTGAAGGCGATGCAGAGGCCGGAG
ACCGCGGCTGTTTTGCGGCGCACGGTGGAGACTTTGTTCG
AGCGCGGCGCGGTGGTCCGGAGCCTGGAGAACCTCGGTGA
ACGCAAACTACCGTACAAGATCTCCAAACACGACTCTCGG
CAATCACACGGCGGATATTTCTCCATTGACTTCCACGCGT
CGCCGAACATAGTCAGCGGGCTGTTGAATCACCTTGAACG
GGACGTTGACGTGCTGCGTCCGACGGTAGTAAAGAAAGAC
ACGGAGCTCCCCAAAGGACAGTGCTGTGGAGTAGCTCGAG
AAGTGAAAGCAAAGATGGCCAGTTAAATGGCTGTGAAGAT
CGCCTCATCTCCTGGATTTTGTGAAGGGATTTTTGCAGCA
GGACGAGCTAGTAAACGCCAGCATCCATTATACAGTTTTG
GAGAAGTGGATTTACGTCAGCTAATCATGTCATGCGTGTT
TTTGTTTAGAAACTGTGTATATATATGATCTCTTGGCAGG
ATTTTTTTCATTGAGTATTTAATTTCAGTGTAACAATATT
TGATTCACAATTTCATGCTCTGAATTAATTAATAAAAAAA
TATTTAAACCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mrps6-201 Contained in:
[BAC] CH211-199I24 (1)

Genome Resources: Vega_Trans:OTTDART00000037590 (1),  Ensembl_Trans:ENSDART00000057774 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH496138 (1) 801 nt
GenBank:BC122263 (1) 712 nt
CITATIONS (2)