Transcript

gbp-201

ID
ZDB-TSCRIPT-090929-17877
Name
gbp-201
Previous Names
  • gbp-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037459 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037459|OTTDARG00000027741|ZDB-GENE-990714-7 gbp|OTTDARP00000030022 gbp-001 LG_ CT027719.4 Danio rerio protein_coding KNOWN, 1359 bp
GGGCAGCGTGGCGGACGCCGGCTAAACGATCCCGTCCATT
TGAATAAAAACAAAAACCACGTCTGGATATTTTGATATCT
GCTTATTTATACAAAATGCCTTGTCGAAAGGAGAACTATA
TTTTTTTGGAACAGTCGGTGACGGTGGATTCAAAGGAAGT
AGACGCTCTCGTGTCGAAAATCGGCGAGGCGCTGCAGCTT
CACAACAATAGCTCAAGCCAGAAGGCGATGTCACGTCTAC
ACGGTTTCACGGGCAGCAAACCGAACGGCGGCGGCGGGAG
CTCGACGGGCGGTCAGCGGTGCATCCGTTTGCGCAGCCGG
AGTTTACGCACCAGCCGGGCCAGTCCATACAACCCGCCCG
GATCCAGCGATCAGGAATGGGACCATTTCAAATCCTCGTG
GAACCGAAAGAAAATCGACGAGGACGATCCGCACCAGCTT
CTGCAGGAACTCATATTGTCCGGGAATCTGATCAAGGAAG
CGGTCAGACGACTCCAGTTTTCATCGGAACCATCGGATCA
CGACATCCCCAAATCTGTGGACTGACTTCCCGAGCCAGCG
GATGCATGAACGTCCTCACGTTTTCAAACGGGGCCGCCAG
CTCATTGGGTTTTTACAAACTTTGATATCACGCCCTTCAT
GTTTTTTCTATTGTACATTGCCGAGATGGACATGTTATGT
ACTTTTTTGACTGTTTTTTGAAATGTGACCCTTCTTTCAT
TTATAAATCTCAGTGTTTGGACTGAAATGCCAACGTGATG
CAAAAATCTAGTGGGTTAACGTTATAGGAATGCATTTATT
ATAGTATTGACTGGCCTCTGGTTGGTTTGTCCTGGAATGG
TGCATCTTGTTTTGGTTTGCTGGAGTTTAGCACTGTGTGT
GTCAGTAGCAAACAAGAACTGCTCAACTGCTTTGTTTACA
ATGTAGATGTGGTCGGGCTGCTGGGTTGCAGTCCTCGCCT
AGATCAGGCAACGGGTCACACCTTTTGTTTACTTGTTTTG
AAACTATGTTTGGATACAAAAATATCACTTTTTTGATTTC
AAACCGGCCCCATGGTCACCTTGTGAGGGCCCATGTCCCC
TGTCCTTTAGATTTCGAAGTGAAGAGCAAGGCCGACACTC
CTTCTCAAAGAGAAACCAAGATCAAACCCACATGCATGTG
GGTACATGTGCTGTACATGGAGGATGTGATCCCGACACAC
TGACACTGTGGTGCTTTTTGATTCCAATGTGGAGTTCTCA
TGTTTATTTTTGTTTTCACTCTGTGTTAACTCTGCATATG
CTTCGCAACGAAGTGTTTTTAATAACTCTGGTTGTTCAGA
GAGTTTGGTGTCTAATAAACATGGTGTTTTTGCATAAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations