Community Action Needed: Please respond to the NIH RFI
Transcript

fbln2-201

ID
ZDB-TSCRIPT-090929-17736
Name
fbln2-201
Previous Names
  • fbln2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037313 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037313|OTTDARG00000027656|ZDB-GENE-060711-1 fbln2|OTTDARP00000029898 fbln2-001 LG_ CR555293.9 Danio rerio protein_coding KNOWN, 5443 bp
CTTTAAAATTCTCAGCGCGCTCAAGCTGCACTGTGTAGGC
TTGATAAAGCAAGTTAGTTGGCTGCAACTTCTAACCTATG
GACACGCACGGAAGAACGTGACCAACGCGAGGTTTCACTA
ACAGCCTGCAGTTCACAAGAGGAGAGTCAACTGTTCAGAG
CCTGGATTGTATTGGGGACATTTATCACCTGTTGATACAC
TAACATCAAGGCAAAATGGGCCGTGGCCTCTTGAACTTGG
CATTTTTGTTGAGTATGAGTGGCTGCCTTGGACAAAAGGA
TTGCACTGGTGTAGATTGCCCTGAACTGCAAAACTGTATA
GAAGAGGTCTTGGACACCGGAGCATGTTGTGCTACCTGTG
TACAAACAGGCTGCATGTGTGAGGGGTACCAGTATTATGA
CTGTATCAGTGCTGGCTTCAGAAACGGCAAGGTTGCAGAA
GGAGAGTCATACTTTGTGGACTTTGGGAGTACTGAATGCT
CTTGTCCACAAGGGGGTGGACGGATCAGCTGCCATTTTAT
ACCATGTCCTGAAGTTCCAGCTAACTGCATAGAATTGTCG
GAGCCGGCAGATGGGTGCATTCAGTGCGAGCGAGTAGGAT
GCGTTCACAAGGATCAGAAGTACGAAGCTGGTCACACATT
CCAAATTGACCCTTGTGAAGTATGCCACTGCCCAAATGGT
GGTGGGGATCTAATGTGCTATCCGGTTCCAAGCTGCAATC
CAAGTCGGGCTTCAAAACCCATGCTGATGACAACAACTGA
AGAAACCACACAAGGGATGCCCTACCGAGACCCCATAATG
CACATTTTTAACAATCAAGGCTCTAGAATTCCCTTTACCA
AACATTTTCCCTTGCATGCCAATAACAATCGTCCTTTTAA
GCTACATATGAGAAAAATAGATGAAAAAGAGGAGGATGAG
GAAGACTATGATTATCCACCCACTGATTACTCAGCTCCTT
CTCATGATGATTTTGCGGCTCCCACAGAGTCATCCATCAT
GTCGGTATCTCGTTCAGATAATTTTACCCCCCACCAGGGT
GTGCACAGGGGTGCTAAGCAAGAGCTGAGAGAGATGCTTG
GTATTCATAGGTCCACAACAGAAAGGCCACAGTTTCCTTT
CTATAAGGACAGTACAGACCGAATGAGAGTAGGCACTCGC
AATGACAAACCAAAAAATGAGCTATTCAGCCCTCTGGAAT
ATAAAACAGACCGGGAACGATTCATCCTTCCTGTGGAAAC
TACAAACAGACTGGGATTCTCCAGTCACAAAGACGCTTCT
GAGATCCATAGCTTTAGTCTTTATAAAGACAGCTTCAATC
AAGAGGCCCTAACAGATGATGAACAGCTTGAATTTCCTTC
AGAAACTACTGATGGGGAAAGAGATACCTCACAGGAGGAC
ACCACATACAGCAAGACAGTTACTGACTCTCCAGTGACTA
TTGAGAAAACTACATCATCTCCACTTTGGGAAACCACAAT
TTCAATGCAAGCTGCTTGGGATGTTGGATCAGAGAGTCAA
ATTCGCAAACTTTTCCCAAATACTGTGGAAACAGATGGCT
CCAAACATGAAGAAACCATCACCAGAGAGTCTAGTAAAGA
AAAAGCAGCTGTTCTGAATGAAACTACAAGTCTGTATGGC
TTTCGATCAATCACTGGTGATCAGAATGAATATATCTTGA
GCACTCCAGATCCTGCTAAGCAAAGTGTGACCATCCCAGC
TGAAACTTTACCAGAACATGAAGAATCAGTAGCCGAAGTT
GAAGATGAACACAAAAGGCTTGCAGTGAACCACAGAGAAC
CACCTGAAGACCACAAACAACTTCCTGTTAAAAACACAAA
ACCCCTTGAGCACCCAAAACCTGAAGAAGAACATGTGCAG
AGCACCTCAGCAAAGCACAACACTGAACTTGAGAGGAAAC
ATCAGTGGCACTTGTTCTCTCCAGTTACCTTCAGTCCAAC
CAGCCCACCTTCAAACAAACAGTCCCACAGTCTGTTTAAC
TTCAGAGAAGAGGAGGACGAGGCAGACAACACCCTCAGAG
CTGCTTTTGTGGATGAGCAAGGACTGGTGGAGAGCTGTTG
TGTGGCCGGGCAGAAATGGGCTGAGGAGAACCAGCAGTGT
AACCGAATGGCTGTCAAAACAGAAGACATCAGCTCTGTGT
GTGGTGTGGTCCAGCAACAGTGTTGTTCGGGTGCTCTGAG
AGAGAGCAGGTGTCAGGCTGGCATCATTGCAGCAAAGGCC
GGACGTGCCTGTCAGAGAAACAGCCCGCTCTGTGGCGAAG
ACTCACAAACAGACTGCTGTAACTGCTGTGCGCTGGGTCT
GCGTTTGCGGAGGGAAGGTAAAGGTTGTGAAGCTCATCAA
TACCTGAGTTACCCATGTGGACACGTCTTCCTCACGTGCT
GTGAAGATGCTGAGGAAGGTCTTCCTCTACCCACCATCAA
GAAAAAGCAGAGGCCTCAGCCAACCGCTCTTCCAAAGAGA
GTATCAGACAGTCAGTTTTGGAAGCAGGCGCTGTCAGCCG
GGGATGTGGATCCCGCAGTTAATTCACTGGAGGATTTGGA
GCATGGTGACAGATGCCAGAGATTTGCTTCGCTCTGCCAT
CACACCTGCATCAACACCCGCGACTCCTACCTGTGCGCCT
GCCACCCCGGGTACACACTCCTGCAGGATGGCCACACCTG
TGTGTCAGAGAACCAGGAGGAAGACAACAGAGTTAGCGAG
GAAGACCGGATCCCTACTACAGTTCCAGATAAACAACAAA
CTACCACTCAGATGCCGGTCTTACATAACCCCTGTGCAGG
TAATGGGCTGTGCTCTCAGAAGTGTACTGTGGTTCAAGAA
CTGGCCCAGTGCTCCTGTTTCCCAGGATTCTTTCTGAAAC
CCGATGGACACACCTGTGAAGATGTGAATGAGTGCCTGAA
CGGCAGACACAATTGCTCCCTGGACGAGGTGTGTAAGAAC
CACGAGGGCTCCTACCAGTGTGAGCGGGTCAATGAGATGT
GCCATAAGGGCTTTATTCACAAACACAATAGAGATTGTGT
GGATGTGAATGAGTGTGTGACGAACACACACACCTGTCGG
GCAGACGAGCGCTGCGTGAACTCAGTTGGAGGATTTGTGT
GCGAAAGGATGATCTTGTGTTCGAGTGGTTACCAGCTGAG
AAATGGAGTATGTGAAGACATCGACGAGTGTGTTATACGA
ACTCATAACTGTGGGATGGGCTTCCAGTGTCAGAATACTG
ATGGTTCATTCACGTGTAAGCCGAAACAACGCTGTCTCAC
AGGCTTCACTCAGGACTCACATGGCAACTGCATTGACATT
GATGAATGCAGCAGTGTGAGAGAACCATGTACGACTGGCT
TCAACTGCATAAATACTGTGGGCTCCTATACCTGTCAGCG
CAAGATCATCATGTGCAGTCGAGGTTACCATTCCAGTCCA
GATGGAGCTCGATGTATTGATGTGGATGAATGTCAGACGG
GCACACACCGCTGTGGAGAAGGCCAAATCTGTCACAACCT
GCCCGGCAGCCACCGCTGTGACTGCCAAACCGGCTACCAG
TACGACACCATCCGCCAGCTCTGTGTGGATGTAAATGAGT
GTTGGCGGTACCCGGGCCGACTCTGTGCCCAGACCTGTGA
AAACACGCCAGGCTCGTACCAGTGCTCCTGTACCACAGGC
TTCTCCTTGGCCTTTGATGGCAAGAACTGTGAAGATATTA
ATGAATGTGACAGCAATCCCTGCAGTCAGGAGTGTGCAAA
CATCTACGGCTCTTACCAGTGTTACTGCCGAGCAGGCTAC
TACCTGAAAGAGGACGGCCACACTTGTGAAGATATTGATG
AGTGCTCACAGAGCATTGGAAACCTGTGTGCGTTTGAGTG
TGTGAACGTGCCAGGGAGCTACACATGTGCCTGTCCTCCT
CATGGTTATTCAATGTCAGCTAATGGACGCACTTGTCAAG
ATATTGATGAATGTGCCATTGGATCGCACAATTGCTCTGC
CTCCCAGACTTGCTTCAACATCCAAGGAGGCTTCCGTTGT
CTGTTGTTTGAATGTCCTGACAACTACAGGAGGGTGTCGG
ACATACGCTGTGAACGAATGAGTTGCCCCAACTACCAACA
ATGCCAGACCATGCCATTACGCATCACCTACTACCAACTG
AGCTTCCAGACCAACATCGTCATCCCAGCTCAGATCTTTC
GAATTGGACCTTCACCCGCATACTCCGGCGACAACATCAT
CATCAGCATCCCGCGCGGAAACGAAGACGGCTACTTCAGC
ACACGGAAGCTCAACAGCTTCACCGGCGCCGTTTACCTAC
ACCGGCAGGTTCGAGAGCCACGGGACTTCTTTATCGACGT
AGAAATGAAGCTGCTACGTCAAGGAACTTTCACAACTTTC
CTGGCCCGCATCTACGTGTTCATCACAGCAAGCTCTATGT
GATGTGATGACACCTTTGATTTCGCATGGTGCTAAACTCT
TCAGGCTTCCGTCTTGAAGTTGTTTGTCATCTGGCAGATC
CTTAAGGCTTCTGTTTGCCTAACGGATTTTTGCTCAGAGA
GACTTTGATGGGACTCTCCCACTGGGATCCAACCGCTTGT
TTTGAGTAGAGCGAGAACAAACAGGACAGAGCATAGAGAC
TGACAGAAACATTTGGCTTTTAAAAATCCTAGTTTTTCCT
CTTCAAAGTATCAAAAGTACTCTACACCAGATGCTATTTA
TACCGCACCAATTTATCTTGATTGCCTGAAACTGCTTTTT
ATAGCACTTCATTACTTTTTCCTAACAACACAAGGTTTCT
CCTAGGGGGTTGGCAGAATAGAGCTGAGGTAGAATTAGGG
GTTTTGTAATGGCTGTCACAAATCCTCCATTCAACTGCTG
TGCCGTTTAAACGTCTAATCATTTCACAGCTCATCCGATA
CAGCAAATAACTGTATTTAAAAACGTACCTGTGTATAATC
CCCACGAGTATACCTCAGTTCACCTCTGCAAACGAGAGAC
ATTGTTTTTGTAATCATTGTTAGCAGTTAAAAAGCTGTAT
GATTGTTATTATTACTGTTTCAAACGGGCTCCGTTCGTAG
CTCTTGGTGCTAATATACGGTTTTGGAAACATTTGACACG
CATACATGAAGAGTGTGTAAGCTCCAAAGCAGCACTGAGA
ATATTGTATTGATAAACGTCAATTTGTATGTCTTTACATT
GTAATACTACACCTGTTTTGATGTATTACTGTCTTGAAAA
TTCATCTCAGGGTTATAGCTTCAAATCATCTCAAGATATG
TTGATATCTGATATCAGAACACATTCCTACTCATTATCAA
AACATATTAGGTAAACTCATGAAACAACCAAATGCATCAG
TATTGCATAAGTATATTAATGCAAGACATATTATCTCCCT
TAATGGATTCAGTTCCTCAATAAAGCAACACCATCATTCC
TTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations