Transcript

six7-201

ID
ZDB-TSCRIPT-090929-17149
Name
six7-201
Previous Names
  • six7-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036700 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036700|OTTDARG00000027330|ZDB-GENE-990825-28 six7|OTTDARP00000029439 six7-001 LG_ BX511131.29 Danio rerio protein_coding KNOWN, 4083 bp
GAATTCGTCCTACCGAGAATCCAGTCGCTCCGTTATATAA
CCGGTCAGCTATATAGTCATTCATATAGTCGTTCAGGCCG
TTGGTTGTCCGTTACTCACACTGGAATGCCGTTGGTATAA
ACGGGCGCGCGAGTTTTCAAATTAGTCAGACAAACCTACA
GCCATGTTTCCTCTGCCGATGTTCACACCTGAGCAGGTGG
CCCGAGTGTGCGAGAATCTCGAGGAAACAGGAGATATCGA
GCGCCTGGGCCGGTTTCTCTGGTCTCTGCCCGCCGCCGTG
CCCGGTTCCGCCGGAGAGTTGCTCAACCGTCATGAGTCGG
TGATGCGCGCGCGGGCTCTCGTCGCGTTCCATGGCGGGAA
TTTCGAGGCGCTCTATCAGATTCTGCAGAGTCACCGGTTT
ACCCGCGAATCTCACGCTAAACTGCAGGACCTGTGGCTGG
ACGCGCATTACCGGGAGGCGGAGCGCCTGAGGGGCAGACC
ACTCGGCCCGGTAGAGAAGTACCGCATCCGTAAGAAGTTC
CCCCTGCCGAGGACAATCTGGGATGGAGAGCAGAAGACAC
ACTGCTTTAAGGAGAGAACCCGCAGTCTGCTGAGGGAATG
GTACCTGCAGGACCCTTATCCAAACCCGTCCAGAAAGCGT
CATTTGGCTCAGGCCACTGGTCTCACTCCCACACAGGTGG
GCAACTGGTTCAAGAACAGGAGACAGCGGGACAGAGCAGC
TTCTGCCAAAAACAGACTACAGCAGGATTCCTCTCTCCTG
CCGTCTGGAAGTTCTCCTGAATGTTCATCATCGGAGCACA
ACCCACTCCTGCGAGGCTCATCCCCCCGCCACCCTGACAG
CCCGGGGAACAGCGACTGCAGCTCAGGCCCTCGGGGGACC
GGAGCTTCCACGCCGGACATCTCGGTCAGCAGCGACAGCG
AGTTTGAGTCGTGAACACAGGCGCACAGACGCTTACTGAT
GATGCACTTACAGCACAGACTGAGAAATCAGCTGGCGGAC
TGCTGGAAAAACTCATTCAGGAGAGGAGTTTTCATTGCAA
GACTGAAACGTGCACTTGAAAGTGACCAGACTGGACCTCA
CGTGCCAAAGAAATCTCCTCAGATTCACTAGCTATGTTTC
CATCAGCGTAAAATACTTCTCTATTTGTATTATAAAAGGT
TATATTTCGGTTTAGGGAGTCTCCAACAACAGTCTGATTT
GCATGCAAGGTCAAAAAACACGTTAATTCTCATATAATAT
GCATTTATTTTTAACTAATTAGCCCAGCGACTCCCATATG
AATCGTTCAGCAATTCATTAGCTCCCAAACCCCTCCTTAG
TACGATGCTGATCTGCGGTGATTAGGCCAATGACCCTATT
GGGTCTATTGCGATTGGTTGACTTGGTTCAGTGCGAGACA
GAGAGAAACATCCATCTATGGCGTAGCACTCAGAGTATGT
GTGAGCCCAATGCAGGAATGCAATAAAGCAATGCAGTCAA
ACAGCAGCATATACTCTACTCTTAACCCTGACCCCAAGTC
AGACACAACACAGATTCAGTATTAATCCTCATAGTGGCAA
AAGTTGAACTGTTTTGAAAACCTCACCGCATGTGTAGGAA
CAGCTGACGGTGGCCATAGTAAAGACAACCAGCAGAAGAT
CACAAGTTCAGGAAAAAAGCATGCGTTGTGCTTTCAACGT
GGATTTGGACGCAATATGTGAACAGCCCCATAAAGATTTT
ACTTGAGAGATACAGTACATGCACTGCTCTGTAATGCTGC
GTTCATACCAGACATGGAAGAAGCGTCAAGCGTGAGTGAT
TTACATGTTAAGTTAATGCAAAGGCGCGAATAGAGACAGT
GTCCCAGGGGAAATCCTCTAGCCGACACCAGCCAACAGTT
GATCGAACTGGGCTCTGCTCAGTCAAAAGCACTGCTGAAA
GCTTCCATCATCCAGGTTAAGTTTCTGAAGAAGTTTGTAA
GCTCATAGAGCTGGGTGCACCTCTGAAAGGATCTAGTGAA
CTCGGACACGGTTCCAAACAAATCAACAATGTTTTTCAGT
CCTCATAAAGCACATAAACACTGTTATTTTCTCAATAAAA
TCCATGTTTGCCATTTAGCAACAATGCTAGTGTCACTCGA
GAGAGTGCCCAGGTCCGCATCTATTGTTCAGTGAATTTGA
TATGAAGCAGATTCGATGCGCAAATGAAGCGAGCAAACTC
AAAATGTTCGTGCATCTATTTTCCATATGAAGTGCAACAG
TTACTGTTGCTGATCTTTCCTTTAATAGCAAACGGCAGGC
GAATCCCACGTTGCAGCGTAGGTTATTGTATCAGTCATCA
GAAAAATGACAGGAGCAAACACAGCACATGGTTGGCTATA
CTGTTGTACTGTAGTGAAAACGGATTTTAACCCTTCCCTG
CAACCGAATCTCCATCTGTCAGTGATCGTCATCTTCTTGT
CATGATCAGTCGCGTGATACTTATCGCTCCGTTAGTGTCA
GAAGGGAAAGGCGCGTTCACGTTTTACTGGAACCTGTACT
ACATATTTGGTGATGTACCGTATCAACGACGACGCATTCA
AGCAAAACATCCAAACCCAACTCGATTCATTCATTCGACT
ATTTCGTTAAAAAAATCTGTAGTTTTACTTAGAGCTGTGT
TACACACTGCACAGAAGTTCATTATCAAAAACCCATAATA
GGGGCTCTTTAATGGAAACGCCAAGATGCGCATCAATTTT
GTAAAAACTTGAGTAGGATCAACTTTATATCCAATAGGAT
AAAATGTGCATAACCTTTGATGGAAAGATGTAAATTCCAG
CATGGTCTTCCTGAAATCCCTCAGCCAAAGTCCATCATCA
CAGTGGTTCAGTATTATTATTATTATTTTGTTATTATTCC
CTCCAGAACTGTCTTGAGCATCTGTCTGTGCTCCCAAAGA
GCATCTCAAGCCTCCAAAAGCCACATCATTGCATTCATCA
TGCCTTCATCTTCATCTTCTGAGGCTCCACTCATTTATTA
GAGAAGAAAAAAGCCCACGGTTGGCTTCTCCTAATGCACA
AAGCTACATTATTCTGTCTGATATTTGTTACCAGTTTATC
AGGAAGTGACGATTTTGTTGTCTTTGACTCATTAGAAGAA
ACGCTGTTTTATTCGCAAATGTTTTATGCGATATTACAGT
TTTGCGTATAAATCTTATTCACCTCTTAGGATGGAAACAT
AGCTACTGGCTGTTTTTATCACATTAATACTCAGGTGGCA
CAAGCATATCATAATCCAGGACGCATTATGCAAATTTTGT
ATGCAAGGCCATTTGTAGCACTATGCACATCTGCCAGAAG
CAGAGGAACGCTCCGGTTTGCATGCTTAAAAAGGGACGTG
TTGGAAACAGAGGCTAGATGTAACTTGCTGCTGTTGGTTT
TCATGAGAATAGAGCGTAGATCAAGCGATTAAGTCTGTTA
TTTGTTTATTTTTATTTGTCGTTTGTGTTGATATGTTTCC
GCCTCCCACTGGAATACACAGATGTGGTCTGGATGAACAT
AAATTAAAGGGGCAGTTCACCCAAAAATGAAAATTGTTGA
AAACCCTGTTTGGCTTTCTTAAGGATGATATACTGAAGAA
AGGTTGAAAGAAACAAAAACAAAAGTCATTGACTTTCATA
GTATTTTTTTGTTCCTACTATGGATGTCAATTGTTGCTTT
TTCATTCTTCAGAATATTTAGTTTTGTGCTCAAAAGAAAA
AAGAAAAGTTTAGAGCCACTTGAATGTGAATGAGGAAATT
TCCATTTTTTCTCTTTAAATGACATGTTATGGGATATTAA
TGCTGCTTATCTGGAAAAATACCATAATTTCTGCGCCACC
ACACACTGTTATCGAACAGGTTTCCTCAACACACTAATGT
TTTCCAAAAGAGACACATCTTTCTGTATATTTCAGCTACT
CCAGTCTGAAGTCATTTTTATGTGCCTACACTTTGAGGAC
GACATGGAAACGTCTAGAATTTGTCATTTTCACACCCATA
TTGCTCACCATTGTCACATGAAGAACTGTACTGTCTTGTT
TTCAATGTGATTTTCAAATAAATGAAATTATTTTTGAAGC
AAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations